WOW !! MUCH LOVE ! SO WORLD PEACE !
Fond bitcoin pour l'amélioration du site: 1memzGeKS7CB3ECNkzSn2qHwxU6NZoJ8o
  Dogecoin (tips/pourboires): DCLoo9Dd4qECqpMLurdgGnaoqbftj16Nvp


Home | Publier un mémoire | Une page au hasard

 > 

La nécropole mérovingienne "la chapelle" de Jau-Dignac et Loirac (Garonne): Détermination de liens de parenté par approche paléogénétique


par Diane Thibon
Université de Bordeaux 1 - Master 2 2009
  

Disponible en mode multipage

Université Bordeaux 1

UMR PACEA 5199

Laboratoire d'Anthropologie des Populations du Passé

Mémoire de Master 2 Sciences et Technologies
Mention Anthropologie Biologique, Paléoanthropologie et Préhistoire
Spécialité : Anthropologie Biologique

LA NECROPOLE MEROVINGIENNE « LA CHAPELLE » DE JAU-
DIGNAC ET LOIRAC (GIRONDE) : DETERMINATION DE LIENS
DE PARENTE PAR APPROCHE PALEOGENETIQUE
ETUDE DE FAISABILITE

Diane THIBON

Sous la direction de Dominique CASTEX et de Marie-France DEGUILLOUX.

Année 2008-2009

Remerciements

Je tiens à remercier toutes les personnes sans lesquelles cette étude n'aurait pu être menée à bien ;

Messieurs les Professeurs J. JAUBERT et P.MURAIL pour m'avoir permis de suivre les enseignements du Master Anthropologie biologique, Paléoanthropologie et Préhistoire.

Marie-France DEGUILLOUX et Dominique CASTEX pour m'avoir dirigée et conseillée dans ce travail ;

Marie-Hélène PEMONGE pour sa gentillesse et sa très grande participation, sans laquelle ce mémoire n'aurait pu être réalisé.

Yannick pour sa patiente et son soutien ;

Et enfin, ma famille pour leurs encouragements et leur réconfort.

Table des matières

Introduction 6

I Présentation du site archéologique de « La chapelle » 9

1. Environnement du site 9

2. Les quatre phases d'occupation du site 11

2.1. Le temple antique 12

2.2. La nécropole mérovingienne 12

2.3. Habitats de la fin du Haut Moyen-âge 14

2.4. Chapelle et cimetière médiéval à moderne 15

3. La nécropole mérovingienne 16

3.1. Pratiques funéraires 16

Les tombes à l'intérieur du bâtiment 16

Les tombes de l'extérieur 17

3.2. Le recrutement par âge et par sexe 18

3.3. Le cas particulier des sarcophages du secteur occidental 18

II Matériel et Méthode 22

1. Généralités techniques sur l'étude de l'ADN ancien 22

2. Matériel 23

2.1. Présentation du matériel 23

2.2. Choix des régions étudiées 24

3. Méthodes 24

3.1. Précautions 25

3.2. Préparations des échantillons 25

3.3. Extraction de l'ADN 26

3.4. Amplification de l'ADN 26

3.5. Vérification de PCR 28

3.6. Clonage 28

3.7. Analyse des séquences 29

3.8. Typage des fouilleurs 29

III Synthèse bibliographique 31

IV Résultats 33

1. Résultats de la synthèse bibliographique 33

2. Résultats des analyses génétiques 39

2.1. Les fouilleurs 39

2.2. Les séquences des individus 39

Sep 169 40

- 1er inhumé : 40

- 2ème inhumé : 41

- 3ème inhumé : 41

Sep 170 42

- 1er inhumé. 42

- 2ème inhumé : 43

- 3ème inhumé : 43

Sep 171 44

- 1er inhumé : 44

- 2ème inhumé : 44

- 3ème inhumé : 45

2.3. Synthèse des résultats 48

V Discussion 49

1. Authenticité des séquences : conservation de l'ADN et contaminations 49

2. Haplogroupes retrouvés 51

3. Liens de parentés 54

VI Conclusion et perceptives 57

Annexe A : protocoles d'analyses d'ADN ancien 59

Bibliographie 62

Liste des figures :

Figure 1 : Localisation de Jau-Dignac en Gironde (in Cartron et Castex 2009) 9

Figure 2 : Localisation de Jau-Dignac en Gironde (in Cartron et Castex 2009) 9

Figure 3 : Vue aérienne de la zone 1 du site archéologique (in Cartron et Castex2009). 10

Figure 4 : Plan général du site archéologique (in Cartron et Castex2008). 11

Figure 5 : Plan de la nécropole mérovingienne (Phase 2) (in Cartron et Castex 2009). 12

Figure 6 : Plan des structures d'habitats (phase 3) (in Cartron et Castex 2009). 14

Figure 7 : Plan de la chapelle et du cimetière médiévaux et modernes (phases 4 et 5) (in Cartron et

Castex 2006). 15

Figure 8 : Sépulture 169, 170 et 171 (in Cartron et Castex 2006). 19

Figure 9 : Schéma d'une amplification d'ADN par PCR (Vierstraete 1999). 27

Figure 10 : Fréquence actuelle de l'haplogroupe J en Europe d'après Logan (2009). 52

Figure 11 : Fréquence de l'haplogroupe X en Europe d'après Logan (2009). 53

Figure 12 : Arbre généalogique montrant quels individus sont issus d'une même lignée

mitochondriale. 55

Figure 13 : Informations acquises en termes de relations de parenté maternelles. 56

Liste des tableaux :

Tableau 1 : Détail des individus inhumés dans les sarcophages. 20

Tableau 2 : Détail des dents utilisées lors de l'extraction 24

Tableau 3 : Amorces utilisées pour chaque fragment (Jehaes et al. 2001). 28

Tableau 4 : Synthèse bibliographique. Critères techniques et résultats. 36

Tableau 5 : Synthèse bibliographique des résultats d'études paléogénétique de liens de parenté. 38

Tableau 6 : Mutations présentes sur la région HVS 1 des fouilleurs. 39

Tableau 7 : Clones obtenus pour chaque fragment et individu. 39

Tableau 8 : Détail des mutations présentes sur tous les clones obtenus. 47

Tableau 9 : Mutations authentiques présentes sur chaque fragment des individus. 48

Introduction

Durant l'antiquité, on observe en Occident une séparation stricte entre le monde des vivants et celui des morts. Selon une tradition romaine, il était interdit d'inhumer les défunts intra muros ainsi qu'au sein des sanctuaires. Du point de vue des pratiques funéraires, on observe à cette époque une gestion quasi exclusive des funérailles par la famille. Les défunts étaient ainsi inhumés aux cotés de leurs ancêtres, comme on peut le voir encore aujourd'hui (Treffort 1996).

C'est durant la période du Haut-Moyen-Age que des changements progressifs vont s'effectuer sur plusieurs niveaux. Ceux-ci sont en grande partie dus à l'installation du christianisme en Gaule. Durant cette période transitoire, entre Antiquité et Moyen-Age, on observe alors des remaniements s'appliquant aux espaces ainsi qu'aux pratiques funéraires. La tradition romaine de séparation se perd peu à peu et l'on assiste à des regroupements de tombes autour de lieux sacrés, prémices du cimetière chrétien retrouvé quelques siècles plus tard. Peu après, on assiste au passage d'une gestion familiale antique des défunts à une gestion plus communautaire menée par l'église (Treffort 1996). Les défunts chrétiens ne sont donc plus préférentiellement inhumés aux cotés de leurs ancêtres mais au sein d'un lieu funéraire regroupant une autre grande famille : la communauté chrétienne.

Le sujet de ce mémoire concerne le site archéologique de Jau-Dignac et Loirac, situé en Gironde, fouillé depuis 2001 par I. Cartron (MC Ausonius, Bordeaux3) et D. Castex (CR, UMR PACEA-LAPP). Ce site est marqué par plusieurs occupations successives dont une nécropole mérovingienne, présente à l'intérieur et aux alentours d'un édifice religieux. Fréquentée du Ve au VIIIe siècle, elle s'inscrit donc parfaitement dans la période de transition des pratiques funéraires énoncées précédemment.

Elle se compose majoritairement de sépultures (sarcophage et autres structures funéraires) primaires individuelles mais quelques sépultures plurielles sont également retrouvées et préférentiellement dans le secteur ouest du site.

Ces sarcophages regroupant 2 à 4 individus posent la question inévitable des liens entre les inhumés. S'agit-il de regroupements familiaux ? Ou bien le regroupement était-il un moyen simple et rapide d'acquérir de la place au sein de la nécropole ? Peut-être doit-on aussi y voir une volonté de rapprochement d'un lieu de culte.

Comme nous l'avons vu précédemment, la composante familiale tend à disparaître au Moyen-Age au profit de l'aspect communautaire. Mais, toutefois celle-ci semble perdurer dans les pratiques funéraires du Haut Moyen-Age (Cartron 2009). C'est donc ce caractère familial que nous souhaitons tester sur plusieurs individus retrouvés groupés au sein des sarcophages de la nécropole de Jau-Dignac. Précédemment, une étude visant à caractériser et comparer des populations du site par l'apport de variations non métriques dentaires a été réalisée (L aforest 2008). Malheureusement aucune information n'a pu être apportée en termes de relation de parenté entre ces individus.

Le mémoire présenté ici s'inscrit dans le cadre d'une étude paléogénétique de liens de parenté. Le principe général de cette étude est d'analyser l'ADN d'individus afin d'observer si ceux-ci présentent des séquences identiques et partagent donc des liens biologiques. Lorsque l'ADN est obtenu, ces analyses paléogénétiques apportent des informations beaucoup plus fiables et plus précises que l'analyse des caractères discrets. On peut ainsi parfois avoir une idée du type de lien (mère-enfant, frère-soeur etc....) qui unit deux ou plusieurs individus, ce qui est une information très intéressante pour la compréhension des pratiques funéraires (Cappellini et al. 2004 ; Haak et al. 2008, etc).

On observe depuis quelques années une multiplication de ce type d'étude. Néanmoins, ces analyses sont compliquées et limitées car elles se heurtent à plusieurs obstacles importants qui sont entre autres : la conservation de l'ADN et la détection de contaminations. Le nombre d'études paléogénétique de liens de parenté publiées est à ce jour assez réduit et la plupart de ces articles ne mentionnent pas toutes les précautions connues aujourd'hui comme nécessaires à l'obtention de résultats fiables. Les résultats sont d'ailleurs généralement fragmentaires, une grande majorité de ces études ne permettant pas d'obtenir d'ADN nucléaire et devant se cantonner à l'ADN mitochondrial.

Nous avons jugé opportun de faire une brève synthèse de travaux publiés pour ce type d'approche (neuf articles), afin de faire le point sur leurs potentialités et leurs limites.

L'ADN mitochondrial, ADN seulement transmissible par voie maternelle, est d'ailleurs le premier marqueur moléculaire utilisé dans ce type d'étude. Il est en effet plus abondant, mieux conservé et donc plus facile à obtenir. Il va en quelques sortes, donner la « tonalité » d'une étude paléogénétique. De mauvais résultats obtenus à partir de cette molécule circulaire ne présage rien de bon concernant l'ADN nucléaire.

L'ADN mitochondrial sera l'unique marqueur analysé dans le cadre de ce mémoire car le sujet de celui-ci ne concerne véritablement que la première étape de cette étude de liens de

parenté, à savoir la faisabilité. Il s'agit donc en premier lieu d'évaluer la présence ou non d'ADN analysable et authentique. Cette étude de faisabilité sera réalisée sur un groupe de neuf individus regroupés par trois au sein de trois sarcophages.

Ce mémoire pourra également apporter des informations méthodologiques. Les analyses présentent-elle beaucoup de contaminations ? D'où proviennent-elles ? Les prélèvements d'échantillons n'ont pas toujours été effectués dans les mêmes conditions ni avec les même précautions. Observe-t-on des différences en termes de contaminations entre les différents prélèvements ? Peut-on identifier des gestes contaminants ?

Si nous parvenons à obtenir de l'ADN mitochondrial authentique chez plusieurs de ces individus, il sera alors possible d'apporter dans ce mémoire des réponses en terme de relations de parenté maternelle. De plus, si cette étude de faisabilité s'avère fructueuse, d'autres analyses plus poussées portant sur l'ADN nucléaire (STR, Chromosome Y) pourront être envisagées afin de repérer d'éventuels liens de parenté paternels et de type parent / enfant.

I Présentation du site archéologique de « La chapelle »

Les données suivantes sont extraites des rapports de fouille (I .Cartron et D .Castex 2006).

1. Environnement du site

Le site archéologique de « La Chapelle » se situe sur la commune de Jau-Dignac et Loirac, sur la rive gauche de l'estuaire de la Gironde et à environ 950 m des berges du fleuve (fig. 1). La rive gauche de l'estuaire se caractérise par une alternance de terrasses argilograveleuses sur lesquelles sont implantés des vignobles et de vastes zones marécageuses comblés par des sédiments détritiques apportés par l'estuaire. Le site archéologique apparait sur un ancien îlot de l'estuaire : le « hameau de Goulée » (fig.2). Les vestiges mis au jour attestent d'une occupation du site depuis l'antiquité, ce qui témoigne d'une mise hors de l'eau de cette partie de l'îlot depuis cette période. Certains documents historiques attestent que dans les années 1630, avant l'assèchement des marais, le rivage de l'estuaire devait être très proche du site archéologique.

Figure 2 : Localisation de Jau-Dignac en Figure 1 : Localisation et environnement du site

Gironde (in Cartron et Castex 2009). de Jau-Dignac (in Cartron et Castex 2006).

Ce site archéologique a été découvert en 2000 à la suite de travaux agricoles. Durant l'été 2000, une opération de sauvetage permettant d'estimer le potentiel archéologique du terrain a été menée par une équipe de l'INRAP sous la responsabilité de C. Scuiller. Cette intervention, comprenant une série de sondages et tranchées, s'est réalisée sur une superficie de 6840 m2 environ. Un décapage de surface, mené aux alentours d'un sarcophage mis au jour à la

découverte du site, a permis de reconnaître l'emprise d'un bâtiment funéraire. Par la suite, d'autres tranchées ont été ouvertes dans plusieurs directions afin de mesurer l'étendue du site. Deux zones sur le site ont ainsi pu être caractérisées :

La zone 1, située sur une butte, compose la majeure partie du site, c'est l'endroit où la grande majorité des vestiges a été retrouvée (fig.3). Cette zone semble avoir été occupée de manière assez importante depuis le Ier siècle après J.-C et l'on peut y observer 4 grandes phases d'occupation attestées, allant de l'Antiquité jusqu'à nos jours.

Figure 3 : Vue aérienne de la zone 1 du site archéologique (in Cartron et Castex2009).

La zone 2, située au sud de la première, semble être plus instable et n'a livré que peu de vestiges, essentiellement quelques tombes laissant penser à un ensemble funéraire secondaire. Contrairement à la zone 1, plusieurs indices archéologiques suggèrent que cette zone fut régulièrement inondée. La zone 2 et le site semblent se limiter au sud par la présence d'un fossé d'une cinquantaine de mètre de long qui devait être un drain ou bien pouvait accueillir une palissade. Au delà, de cette limite sud, la terre semble stérile.

En 2001, une campagne de fouille dirigée par I. Cartron et D. Castex a permis de mettre au jour une surface de 300m2 correspondant à l'emprise d'une chapelle (Zone 1). La fouille de ce site, prolongée de 2003 à 2005 sous forme de d'opération programmée triennale et de 2007 à 2009, fait l'objet d'un chantier école, permettant ainsi à de nombreux étudiants de venir chaque année acquérir des techniques de fouilles propres à l'archéologie et à l'anthropologie.

La problématique de se site s'insère dans un contexte de compréhension de genèse des espaces funéraires et des lieux de cultes pour l'Antiquité tardive et le Haut Moyen-Age. La

fouille relève de méthodes propres au domaine de l'archéothanatologie, discipline dont l'objectif est de reconstituer les modes de dépôts des défunts et les pratiques funéraires qui en découlent. Il s'agit donc d'une fouille fine avec des prélèvements et des enregistrements précis des ossements et du mobilier (Duday 2005). Ce site possède l'avantage d'avoir été occupé sur une très longue durée (de l'Antiquité à l'époque moderne), ce qui permet donc de pouvoir être attentif aux questions de transition, de changement de fonction du site (habitat, lieu de culte, espace funéraire, passage d'un espace privé à public ou l'inverse) en même temps qu'à sa chronologie (continuité d'occupations, ruptures) (Cartron et Castex 2007). La compréhension de l'environnement naturel et de son évolution au cours du temps revêt également une grande importance dans l'étude de ce site puisqu'il permettra de comprendre assurément la longue occupation d'un ilot des rives de l'estuaire. L'estuaire est depuis très longtemps une voie fluviatile de pénétration et d'échanges primordiaux en Aquitaine, ce qui pourrait donc être une piste pour expliquer cette très longue occupation.

Nous allons maintenant résumer brièvement les quatre grandes phases d'occupation de ce site (fig.4)

2. Les quatre phases d'occupation du site

Figure 4 : Plan général du site archéologique (in Cartron et Castex2008).

2.1. Le temple antique

La phase d'occupation la plus ancienne du site se manifeste par la présence d'un fanum. Ce petit temple antique, constitué d'une cella carré, d'une galerie périphérique et d'un pronaos, aurait été utilisé autour du Ier siècle après J.-C, puis abandonné à la fin du IVe siècle (fig. 4). Les pièces de monnaie retrouvées au sein du temple, permettraient de dater certains niveaux d'occupation du temple mais malheureusement la période de sa fondation reste obscure. De plus, malgré la découverte de nombreux vestiges au sein de cet édifice (différents types de monnaies, nombreuses clochettes en bronze) aucun culte lié au fanum n'a pu être identifié.

2.2. La nécropole mérovingienne

Figure 5 : Plan de la nécropole mérovingienne (Phase 2) (in Cartron et Castex 2009).

Après un hiatus d'occupation pour les Ve et VIe siècles, le temple et ces alentours sont transformés en espace funéraire (fig.5). Les ruines du temple sont aménagées pour servir de bâtiment funéraire autour duquel une petite nécropole s'est développée au fil du temps. A ce jour, une cinquantaine de tombes ont été découvertes. Cet espace funéraire se compose de

plusieurs regroupements plus ou moins évidents dont les sépultures ont -pour une grande partie- la caractéristique commune d'être alignées selon un même axe nord- est/sud- ouest.

Le groupe le plus apparent est retrouvé au sein même du bâtiment funéraire réaménagé sur l'ancienne cella. Ce bâtiment, une église semblerait-il, rassemble un groupe de 11 sépultures plus ou moins alignées contre les parois nord et sud de l'édifice dans un sens nord-est/sudouest. L'alignement de ces sépultures suggère un fonctionnement de circulation au sein de l'église selon un axe ouest/est avec une ouverture principale à l'ouest. On compte parmi ces sépultures six sarcophages ainsi que deux coffrages de bois.

Le deuxième groupe de sépulture marqué est situé dans la partie occidentale de la nécropole. Il semble presque en décalage avec les autres groupes car les sépultures (uniquement des sarcophages) semblent moins nombreuses et mieux organisées. Ce petit ensemble funéraire se compose de sept sarcophages dont cinq sont regroupés distinctement. Parmi ces cinq tombes, trois d'entre elles forment une rangée parfaite. Toujours à l'Ouest mais plus proche de l'église, les deux derniers sarcophages ont causés l'arasement du mur Ouest des anciennes galeries du fanum. Le même phénomène est observé au niveau de la galerie sud ou deux sépultures se sont installées sur le mur et à l'intérieur de la galerie.

Dans cette même région sud, une quinzaine de sépultures sont regroupées de manière désordonnée. Ces tombes, beaucoup de coffrage de bois et quelques sarcophages, sont toujours orientées sommairement dans la direction nord-est/sud-ouest, hormis deux sarcophages dont l'orientation est radicalement différente (sud-ouest/nord-est). On observe des calages en pierre autour de la majorité des fosses situées dans ce secteur. Une étude plus précise des ces tombes est en cours.

La partie nord comprend globalement 9 sépultures, dont 3 sont des sarcophages presque détruits. Sept d'entre elles semblent disposées parallèlement aux parois intérieure et extérieure de la galerie du fanum.

La zone la plus à l'Est est un peu plus confuse et se compose approximativement de 12 sépultures ne comprenant aucun sarcophage. Trois fosses sont disposées parallèlement à la paroi de l'édifice et sont donc orientées dans une direction nord/sud, orientation perpendiculaire à la majorité des autres tombes. Pour finir, quatre petites fosses entourées de calage de pierre ont été trouvées plus ou moins regroupées à l'extrême Est de la nécropole.

A l'issue de cette description, nous pouvons remarquer qu'il existe donc une certaine hétérogénéité non seulement dans la disposition des sépultures au sein des pôles et entre pôles

mais également dans la nature même des ces tombes mérovingienne (sarcophages, contenants en bois avec ou sans calage de pierre, avec ou sans aménagement particulier).

Selon les responsables de la fouille et des études, cet espace funéraire privé, de type oratorium, aurait constitué un lieu de mémoire familiale à la fin de l'époque mérovingienne. L'utilisation de cet oratorium se serait achevée autour du XIe siècle, période à laquelle cette petite église fut détruite.

2.3. Habitats de la fin du Haut Moyen-âge

A la nécropole mérovingienne succède une occupation qui suggère la présence de petits habitats, de type cabane, dont subsistent surtout des structures en creux (fosses, silos, trous de poteaux) (fig.6). Ces structures laissent penser que l'église aurait été totalement détruite et de nombreuses cuves de sarcophage auraient également été arasées sans doute pour la récupération des matériaux. Ces destructions forment une bande ouest-est sur laquelle se concentrent les vestiges d'habitats. Iles concernent les restes d'une première cabane située à l'angle sud ouest, formé par les anciens murs du fanum ainsi que d'autres éléments (silo, structure en tuiles) dans la zone est. Plusieurs petites fosses et trous de poteau sont également observés de manière assez éparse sur le site. On peut dénombrer aujourd'hui quatre petits habitats dispersés. Malheureusement, il n'a pas été possible de dater précisément ces vestiges en raison du peu de matériel retrouvé. Il a été proposé une large fourchette chronologique comprenant une période s'étalant du IXe au XIe siècle.

Figure 6 : Plan des structures d'habitats (phase 3) (in Cartron et Castex 2009).

2.4. Chapelle et cimetière médiéval à moderne

C'est entre le XIIIe et XVe siècle, et fort probablement par hasard, que le site est de nouveau utilisé. Une chapelle est alors construite à peu près au même emplacement que les précédents bâtiments (fig. 7). Ce dernier type d'occupation est assez mal représenté sur le site car il se compose de niveaux presque totalement arasés par les labours successifs. De plus, la totalité des matériaux de construction de la chapelle ont été récupérés, y compris les fondations, ce qui explique également que seuls les négatifs du bâtiment aient été mis à jour. Les quelques informations retirées de ces négatifs indique une chapelle à nef unique avec une abside semi circulaire et deux piliers à l'entrée. Par la suite, un porche fut adjoint à la partie occidentale de la chapelle. Les sources écrites nous apprennent que cet édifice fut fréquenté et maintenu en bon état jusqu'en 1737 puis laissé à l'abandon dans les années 1780. La chapelle fut fermée en 1787 puis vendue en 1792.

Figure 7 : Plan de la chapelle et du cimetière médiévaux et modernes (phases 4 et 5) (in Cartron et Castex 2006).

Autour et à l'intérieur de cette chapelle, de nombreuses sépultures ont été mises à jour.

Ce cimetière, en grande partie localisé sur la zone 1 (32 sépultures) mais aussi sur la zone 2 (7 sépultures), fut utilisé du bas Moyen-Age à l'époque moderne. Malheureusement, pour ce

dernier stade d'occupation, il a été difficile de bien séparer chronologiquement les vestiges médiévaux (phase 4) des vestiges modernes (phase5).

3. La nécropole mérovingienne

L'organisation, la disposition spatiale des sépultures et des différents pôles de cette petite nécropole ont été en partie détaillée dans la première partie du mémoire, nous nous attarderons donc ici plus particulièrement sur les pratiques funéraires mises en oeuvres au sein de celle-ci.

3.1. Pratiques funéraires

Le groupe mérovingien présent au sein de la nécropole peut sommairement être scindé en deux : les sépultures présentes à l'intérieur du bâtiment et toutes celles à l'extérieur. Ces deux zones funéraires se distinguent sur plusieurs aspects :

- - le type de sarcophage utilisé. Cette différenciation se base sur la morphologie

des cuves, le matériau utilisé, ainsi que la technique de taille des sarcophages.

- la présence ou non de mobilier.

- le nombre et le mode de dépôts des défunts.

 

/ Hs Wo& bHs à ieli2WéaiHua du bliWi& H2W

L'intérieur de l'édifice abrite exactement 11 tombes dont une grande majorité est représentée par des sarcophages. Fabriqués en calcaire coquiller, ces sarcophages trapézoïdaux qualifiés de type 1 ou de « Bordeaux » (Cartron et Castex 2006), se divisent en deux types de décors. Dans la majorité des cuves, un riche mobilier comprenant plaques boucle, boucles de chausse et autre est associé au défunt. Selon les auteurs, les individus enterrés dans ce bâtiment rectangulaire constitueraient un groupe sélectif d'inhumations plus prestigieuses. En témoigne en particulier un sarcophage (sep 014), contenant une femme d'âge entre 20 et 29 ans qui se distingue par la présence d'une bague en or massif datant du IIIe --IVe siècle. Cet espace funéraire constituerait une petite nécropole aristocratique familiale du haut Moyen Âge (Cartron et Castex 2009). Le bâtiment pourrait correspondre plus particulièrement à une mémoria, c'est-à-dire à un monument funéraire en relation avec la mémoire d'un groupe d'individus. Toutefois, il semble difficile d'y attester un culte chrétien (Cartron et Castex 2006).

Concernant le nombre et le mode de dépôt des défunts au sein de ces sarcophages ; seul

deux d'entre eux semblent avoir fait l'objet de dépôts primaires individuels (sep 013 et 014) perturbés postérieurement. Les autres sarcophages de l'édifice, semblent quant à eux avoir fait l'objet de réutilisations avec superposition d'un seul individu associé à quelques manipulations d'ossements pratiquées sur le 1 er inhumé. Notons que le mauvais état général de certains individus retrouvés au sein de ces sépultures réutilisées, n'a pas permis de diagnose sexuelle et d'estimation fiable de l'âge. En conséquence, aucun regroupement fondé sur ces critères n'a été mis en évidence.

La mémoria, se compose majoritairement d'adultes, mais abrite néanmoins deux sépultures individuelles d'immature. Contrairement aux adultes, aucun mobilier n'est associé

a ces enfants, inhumés dans ce qui pourrait être un contenant en bois.

 

/ IKINP Hifielieff té1IIA1

La nécropole entourant l'édifice comporte une quarantaine de sépultures. Ces tombes, plus ou moins regroupées en pôle aux quatre points cardinaux de l'église, semblent se démarquer de celles retrouvées pour la même période à l'intérieur du bâtiment. Ces sépultures, des sarcophages mais aussi des coffrages en bois et des cercueils, ne contiennent que très

rarement du mobilier. L'unique exception étant un sarcophage isolé situé à l'Est du bâtiment

ou une fibule a été mis au jour au coté du défunt. Cet unique mobilier ainsi que les datations C14 sur les ossements permettent de dater l'installation de ces tombes au milieu du VIIe siècle (Cartron et Castex 2006).

Au sein de cet ensemble, un nouveau type de sarcophage, qualifié de type deux est retrouvé dans la partie ouest. Dans ce secteur, les sarcophages sont taillés dans un calcaire blanc et fin et semblent former un groupe assez homogène et différent de ceux du type 1. Au sud ainsi qu'au nord du bâtiment, quelques sarcophages sont en calcaire coquiller mais il semblerait que seul deux d'entre eux (sep 092 et sep 093) soit assimilable à ceux de la mémoria, de par le matériau et la technique de taille utilisée. Les sarcophages au sud et à l'est de la nécropole n'ont pas pu être rapprochés d'un des deux types car mal conservés, ou encore non fouillés. Certains d'entres eux pourraient également appartenir à un troisième type. Les

sarcophages de la zone extérieure ont, pour une grande majorité, été réutilisés. Parmi eux, on

observe des cas de superpositions avec quelques manipulations d'ossements (sep 092, 094 et

169), des cas de superpositions multiples (jusqu'à 4 individus) accompagnés de réductions
pour les sépultures du secteur ouest (sep 170, 171, 172) et quelques regroupements

d'ossements issus de gestes indéterminés. Les 17 autres sépultures en contenant en bois ne semblent pas avoir fait l'objet de réutilisation (Gleize 2006).

La position des individus lors de leur dépôt a pu être en grande partie reconstituée. Il semblerait que la majorité des individus, à l'intérieur comme à l'extérieur de l'édifice, ait été couchée sur le dos, les membres inférieurs en extension. Dans les cas, ou elle a pu être déterminée, la position des avants bras est basse, le long du corps ou ramenée vers le bassin ou l'abdomen. Quelques exceptions confirment néanmoins la règle ; certains jeunes enfants peuvent être retrouvés en position foetale, comme dans le cas des sépultures 210 et 170, mais il serait cependant imprudent de rapprocher ces deux cas. L'individu de la sépulture 217 se démarque également par la position de ces pieds, semble t-il croisés.

Dans plusieurs cas, les observations taphonomiques ont permis d'émettre l'hypothèse de l'existence de brancard (sep 122) ainsi que des supports en matière périssable sous la tête (sep 191).

La plupart des jeunes enfants sont retrouvés en dépôt primaire individuel dans des contenants en bois, ainsi que nous avons pu l'observer à l'intérieur de l'édifice (sep 210, 243 et 217). Cependant, seul l'un d'entre eux, un périnatal retrouvé dans le secteur ouest (sep 170), semble bénéficier d'un sarcophage, fait rare à cette époque.

3.2. Le recrutement par âge et par sexe

La nécropole extérieure, comme intérieure, se compose majoritairement d'adultes et, comparé à une population archaïque, il existe un déficit général pour les individus de moins de quinze ans. La prise en compte des taux de mortalité montre que cette différence est du à un biais important chez les immatures de moins de dix ans (Cartron et Castex 2006). Il est par ailleurs important de noter que lors de la post fouille de 2005, il a été mis en évidence dans les niveaux archéologiques de cette zone de nombreux ossements erratiques, généralement immatures. Il est bien entendu difficile de savoir si ces sépultures se rattachent à cette période mais de ce fait, il faut donc considérer cette population mérovingienne comme relativement biaisée.

3.3. Le cas particulier des sarcophages du secteur occidental

Comme nous l'avons vu précédemment, l'ensemble des sarcophages situés dans le secteur occidental de la chapelle forme un groupe relativement défini et homogène au sein de la nécropole extérieure. En effet, cet ensemble de sept sarcophages taillés dans un même type de

calcaire se démarque des autres sur certains aspects. Outre le type de sarcophage, ces sépultures ont en majorité été réutilisées de multiples fois, allant de deux à quatre fois, ce qui est une pratique spécifique à cette zone. A côté de cela, le groupe est topographiquement bien identifiable du fait que quatre des sept sépultures sont très resserrées et alignées de façon organisée. De plus la position du groupe dans la nécropole, face à l'édifice, et la présence d'une agrafe tardive pourraient suggérer une datation postérieure aux inhumations réalisées dans le bâtiment. L'élément le plus notable reste encore le fait qu'un de ces sarcophages renferme un périnatal, fait qui soulève un certain nombre de questions. Quelle est la raison de la présence de cet individu au sein de ces sarcophages ? Est-il apparenté à l'un des individus inhumé à ses côtés ?

Figure 8 : Sépulture 169, 170 et 171 (in Cartron et Castex 2006).

Des prélèvements de mandibule, en vue d'analyse génétique, ont été effectués sur chacun des 13 individus des sépultures 169, 170, 171 et 172 (La figure 8 présente uniquement les sépultures des individus analysés dans le cadre de cette étude). Ces prélèvements présentent un double intérêt. Ils pourraient tout d'abord permettre la compréhension du fonctionnement de ces sarcophages, groupe archéologiquement pertinent, ainsi qu'une discussion sur un éventuel lien de parenté entre les individus d'une même structure (Castex et Cartron 2007). Ils

pourraient dans un second temps apporter des informations d'ordre méthodologiques. Ces prélèvements ont été effectués avec plus ou moins de précautions suivant les sépultures. Il s'agirait donc d'observer si ces différences ont eu des répercutions sur les analyses génétiques.

Pour ces quatre sépultures, il convient de noter que les couvercles des sarcophages étaient absents mais les cuves, bien conservées, présentaient un remplissage homogène.

Le tableau ci-dessous (tabl .1) détaille l'âge et le sexe des individus inhumés dans chaque sarcophage. Seuls les sarcophages analysés en lors de notre étude paléogénétique sont présentés dans ce tableau.

 
 
 
 

umé

me

inh

 
 
 
 
 

3me

 

nhmé

Tableau 1 : Détail des individus inhumés dans les sarcophages.

La sépulture 169, accueillait 3 individus dont les dépôts superposés et différés dans le temps, n'ont entrainé que très peu de manipulations des premiers inhumés.

La sépulture 170 est un peu plus complexe. Lors de la réutilisation de la cuve, le squelette du 1er inhumé a été en partie réduit et une grande majorité de ces os ont été retirés puis redéposés sur le deuxième inhumé. La position décentrée de la jeune femme ainsi que l'enchevêtrement de ces os avec ceux du périnatal laissent penser à un éventuel dépôt simultané de ces deux corps. Une relation mère-enfant unirait-elle ces deux derniers inhumés ? Cette information pourra peut-être être apportée par des analyses génétiques. Par ailleurs, l'hypothèse d'un support en matière périssable type brancard ou civière a été émise face à la présence d'un espace vide situé sous la jeune femme. Pour finir, signalons également la découverte d'une agrafe à double crochet dans le remplissage de la cuve qui renvoie à la période du mérovingien récent 3 (entre 660 et 750 ap. J.-C).

La sépulture 171 a fait l'objet de plus de remaniements. En effet, les deux premiers inhumés, au départ superposés, ont subi plusieurs manipulations avant le dépôt du 3ème individu. Ainsi, certains de leurs ossements auraient été sortis puis redéposés dans les angles

du sarcophage, sans doute de manière à ménager le plus d'espace pour la superposition du dernier inhumé.

D'un point de vue paléopathologique, aucune lésion importante n'a été décelée chez ces treize individus. Bien au contraire, on note une absence d'hypoplasie linéaire chez six d'entre eux alors que cette pathologie de l'émail dentaire est fréquente à 68 % (12/ 19) dans l'effectif de la population de la nécropole (Gleize 2006).

La recherche de caractères discrets osseux s'est montrée infructueuse (Cartron et Castex 2006 ; Gleize 2006). Une étude menée sur les caractères discrets dentaires des individus de la nécropole n'a malheureusement pas permis d'apporter d'information intéressante laissant penser à un quelconque lien de parenté entre certains de ces individus (Laforest 2008). La présence d'un même caractère est cependant observé (entocunulide sur une M3 inférieur) sur deux individus du sarcophage 172.

II Matériel et Méthode

1. Généralités techniques sur l'étude de l'ADN ancien

Depuis une vingtaine d'année, la paléogénétique a permis d'apporter de nombreuses réponses aux anthropologues et paléoanthropologues. Ainsi, elle peut permettre aujourd'hui : l'identification d'individus, de relations de parenté, mais aussi la confirmation des origines et des migrations humaines ou encore la reconstruction des phylogénies d'espèces éteintes. Malheureusement, les études sur l'ADN ancien sont limitées par plusieurs facteurs importants.

La dégradation de la molécule d'ADN est le premier obstacle aux analyses génétiques. En effet, l'ADN est dégradé, de manière plus ou moins importante suivant les conditions de conservation, par plusieurs mécanismes chimiques et biologiques comme l'autolyse, l'hydrolyse, l'oxydation ou encore la lyse par des microorganismes. L'ADN récupéré se trouve bien souvent fragmenté (taille < 250pb) et chimiquement modifié (présence de déaminations).

Le deuxième obstacle rencontré est la présence d'inhibiteurs de PCR. En effet, des impuretés, présentes dans les extraits, peuvent venir inhiber la réaction d'amplification de l'ADN.

Pour finir, le troisième obstacle à ces analyses est le risque important de contamination par de l'ADN exogène moderne. Il existe en effet plusieurs sources possibles de contaminations. Celles-ci peuvent provenir des fouilleurs, des manipulateurs, des produits utilisés pour les analyses ou encore des analyses antérieures (séquences précédemment amplifiées au laboratoire) (Yang 2005 ; Cooper 2000).

Même si différentes précautions sont prises (clonage, multiples contrôles), afin de repérer ces contaminations, il apparaît souvent difficile d'isoler et d'identifier la séquence authentique, surtout quand il s'agit d'ADN humain. Afin d'éviter au maximum ce phénomène de contamination, il convient donc de prendre des précautions et de suivre rigoureusement les protocoles appropriés.

Les analyses sur l'ADN ancien visant, entre autres, l'étude de lien de parenté ou de migration de population, se concentrent en premier lieu sur l'ADN mitochondrial. Cette

molécule circulaire de petite taille (16569 Pb chez l'homme - Anderson 1981), située dans les mitochondries, présente plusieurs caractéristiques intéressantes pour ce genre de problématique. La première est que cette molécule est présente en grande quantité au sein de la cellule vivante, environ plus de mille copies par cellule, alors que l'ADN nucléaire n'est présent que par deux copies. Cela facilite donc son obtention sur des vestiges anciens. De plus, grâce à ça taille réduite, cette molécule circulaire à pu être entièrement séquencée (séquence de référence de Cambridge) et l'on y observe la présence d'une région non codante (D-loop) hypervariable dont le taux de mutation est particulièrement élevé. Ce dernier aspect permet ainsi de pouvoir reconstituer l'histoire évolutive ainsi que les mouvements migratoires sur un laps de temps de quelques milliers d'années. Le dernier élément important à noter est que cette molécule est transmise uniquement par voie maternelle et ne subit pas de recombinaison, ce qui bien entendu simplifie grandement les études phylogénétiques. Néanmoins, l'héritage génétique n'étant que maternel, seulement la moitié de l'histoire évolutive et des liens de parenté pourra être reconstruite.

2. Matériel

2.1. Présentation du matériel

Le matériel osseux utilisé pour cette étude est constitué des 9 mandibules d'individus retrouvés dans les sarcophages 169, 170 et 171 de la nécropole. Ceux-ci ont été prélevés lors de la campagne de fouille menée par D. Castex et I. Cartron en 2005. Le choix du matériel se justifie essentiellement par le fait qu'il a été montré que les dents en place et intactes présentent un taux de conservation de l'ADN plus important que les os (Shultes 1999). Des dents ont donc été prélevées chez 8 individus sur 9. Aucun type de dent n'a été privilégié, le choix privilégiant surtout les dents non endommagées et non cariées. Le tableau n° 2 présente le type de dent utilisé pour l'extraction de l'ADN. Concernant le périnatal, il n'a bien sur pas été possible d'utiliser de dent, une hémi mandibule a donc été utilisée à la place.

N°Sépulture

169

170

171

1er inhumé

M3

P1

C

2ème inhumé

M2

M2

M3

3ème inhumé

M3

X

P1

Tableau 2 : Détail des dents utilisées lors de l'extraction.

Les conditions de prélèvement des échantillons sur le site ont été assez variables.

Les prélèvements des individus du sarcophage 169 ont fait l'objet de précautions tout à fait rigoureuses, tel que le port de masque, de gants, nettoyage systématique des outils à la javel puis mis en congélation immédiate des échantillons. Pour plusieurs auteurs (Poinar et al. 2003 ; Gilbert 2005), toutes ces précautions prises lors des prélèvements sont essentielles et permettent de limiter sérieusement les contaminations exogènes.

Les individus des sarcophages 170 et 171 n'ont pas fait l'objet de si grands soins. En effet, les prélèvements ont été effectués sans gant. Néanmoins, les échantillons ont été mis en sachet immédiatement après avoir été prélevés, n'ont pas été lavés et ont été conservés à -20°C jusqu'aux analyses. Bien que ce dernier aspect soit regrettable, il sera néanmoins intéressant, d'un point de vue méthodologique, de comparer les résultats d'analyse ADN issus de prélèvements avec et sans port de gant.

2.2. Choix des régions étudiées

Pour tous les arguments énoncés précédemment, notre analyse s'est portée en premier lieu sur l'ADN mitochondrial. Nous avons décidé de nous concentrer uniquement sur la région de contrôle (D-Loop) même si la région codante est parfois indispensable pour la confirmation de certains haplogroupes. Cette région hypervariable, comme nous l'avons dit, est partagée en 2 segments de taille réduite : HVRI (421pb) et HVRII (383pb). Seul la région HVRI a été analysée car c'est la région pour laquelle les bases de données sont les plus riches. L'ADN ancien étant très souvent dégradé, cette région sera fractionnée lors de l'amplification. Nous obtiendrons donc, lors des résultats, quatre fragments chevauchants et courts A, B, C et CC reconstituant la région HVR1.

3. Méthodes

L'analyse génétique se divise en deux grandes étapes importantes.

La première est l'obtention des séquences ADN, par les méthodes d'extraction, d'amplification de l'ADN, de clonage et de séquençage qui vous seront décrites.

La seconde est l'analyse de ces séquences: alignement des séquences de clones, détection de contaminations et de déaminations, authentification des séquences, comparaison avec d'autres séquences issues de base de données, et identification d'haplogroupe. Le détail des protocoles est présenté dans les annexes (annexe A).

3.1. Précautions

Bien entendu, un certain nombre de précautions vis-à-vis des contaminations doivent être prises tout au long de la première étape et notamment avant l'amplification ADN, puisque tout contaminant intégré est préférentiellement amplifié par la PCR. Neuf critères d'authenticité de l'ADN ont été élaborés (Gilbert 2005 ; Poinar 2003). Les plus importants d'entre eux ont été respectés dans le cadre de cette étude :

- Échantillonnage propre

- Port de gants, charlotte, combinaison, blouses. - Utilisation de matériel et ustensiles stériles.

- Nettoyage régulier du matériel et de la paillasse à la javel et aux UV.

- Séparation physique des laboratoires ADN ancien - Salle blanche en surpression, avec sas et UV

- Séparation des salles d'extraction et de préparation des PCR

- Séparation des laboratoires pré et post-PCR

- Plusieurs contrôles négatifs d'extraction et de PCR - Clonage puis séquençage des produits PCR

Il est important d'insister sur le fait que la détection de contaminations est essentielle et plus encore dans cette étude. En effet, de par sa provenance géographique ainsi que sa faible ancienneté (seulement 1500 ans), ce matériel génétique pourrait être tout à fait comparable et similaire aux contaminations exogènes modernes potentielles (manipulateurs, réactifs), rendant ainsi l'authentification plus ardue.

3.2. Préparations des échantillons

Les échantillons, après avoir été prélevés, ont été placés au congélateur dans des sachets stériles empêchant tout contact avec l'extérieur.

En laboratoire, des dents en place non cassées sont été extraites des alvéoles, raclées à l'aide d'un scalpel puis nettoyées à la javel et rincées à l'eau stérile (le tout sous hotte stérile UV). L'échantillon préparé est ensuite mis en sachet stérile double marqué.

3.3. Extraction de l'ADN

Cette étape se déroule sur une demi-journée en salle blanche. Il convient de signaler une fois pour toute que tout le matériel contenu au sein de cette salle est stérile. La stérilisation des locaux et matériels est obtenue par nettoyage à la javel et exposition aux UV.

En premier lieu, la dent est broyée grossièrement à l'aide d'un marteau puis la poudre en résultant est mélangée à un tampon de lyse (EDTA + NaOH + N-Lauryl sarcosyl + Protéinase K). Le tout est placé en étuve à 37°C toute la nuit. Cette étape de « digestion » va permettre la lyse des cellules et la libération des acides nucléiques de l'échantillon au sein de la solution. Le deuxième jour, la solution subit une étape de déprotéinisation, par séparation sur gradient de phénol-chloroforme. Cette étape va permettre la séparation de l'ADN et des constituants lipidiques et protéiques. Cette deuxième journée s'achève avec la filtration et purification de l'extrait grâce à des colonnes (Centricons). Cette dernière étape permet la concentration de l'ADN ainsi que l'élimination de diverses particules inhibitrices de PCR. Parallèlement, un tube témoin extraction (sans ADN) suit l'étape d'extraction.

3.4. Amplification de l'ADN

Cette étape débute avec le mélange des réactifs PCR ou mix réalisé en salle blanche mais au sein d'une petite pièce spécifique. Ce mélange contient des dNTP (désoxyribonucléiques tri phosphates) qui permettront l'étape d'élongation, l'enzyme Taq polymérase qui va réaliser cette polymérisation ainsi que les amorces spécifiques qui servent de point d'ancrage et de départ à la polymérisation. Associé à cela d'autres constituants comme du tampon 2x, du BSA, du Mgcl2 et de l'eau sont incorporés au mélange. Une fois l'ADN ajouté, le mélange est prêt pour l'amplification.

La technique de la PCR (Polymerase Chain Reaction) permet l'amplification de fragments d'ADN à partir de très petite quantité d'ADN. Ce système, indispensable en paléogénétique, va ainsi nous permettre d'obtenir des millions de copie de notre région cible HVRI. Comme il est possible de le voir sur la figure 9, cette PCR se déroule en 3 étapes et est réalisée par une seule et même machine destinée à cette fonction (thermocycler).

La dénaturation, étape de séparation des deux brins d'ADN, s'effectue en une minute à une température de 94 O.

Lors de l'étape suivante, l'hybridation, un couple d'amorce spécifique va venir s'hybrider sur les brins d'ADN (voir détail des amorces spécifiques à chaque fragment tableau 3). Cette étape dure 45 secondes et la température d'hybridation est spécifique au couple d'amorce utilisé.

Pour finir, l'ADN est synthétisé lors de la phase d'élongation ou polymérisation. Cette étape ne dure qu'une minute et est réalisée à une température de 72°C.

L'ADN est ainsi synthétisé de manière exponentielle durant un nombre de cycle prédéfinis. Au sein du LAPP, 45 cycles sont estimés nécessaires pour une bonne amplification. Le risque étant qu'un nombre de cycles trop important rende la PCR plus sensible aux contaminations, aboutissant ainsi à la détection quasi-systématique d'ADN contaminant (liés aux réactifs) au sein des témoins (Yang 2003).

Figure 9 : Schéma d'une amplification d'ADN par PCR (Vierstraete 1999).

De la même façon que lors de l'extraction, un témoin négatif PCR est réalisé. Une fois l'ADN transporté dans une autre salle, un autre témoin aérosol contenant le mix PCR reste ouvert pendant tout le temps de la manipulation afin de vérifier la pureté de l'air de la salle blanche.

Fragment

Amorce

séquences des amorces

ille (pb)

HVSI complet

HVSIcompU

CCCAAAGCTAAGATTCTAAT

421

56

 

HVSIcompL

GAGGATGGTGGTCAAGGGAC

 
 

HVSI A

HVSIaU

CCCAAAGCTAAGATTCTAAT

186

56

 

HVSIaL

TGGATTGGGTTTTATGTA

 
 

HVSI B

HVSIbU

TGACCACCTGTAGTACATAA

174

56

 

HVSIbL

GGAGTTGCAGTTGATGT

 
 

HVSI C

HVSIcU

CCCCATGCTTACAAGCAAGT

261

56

 

HVSIcL2

GAGGATGGTGGTCAAGGGAC

 
 

HVSI CC

HVSIccU

CCCCATGCTTACAAGCAAGT

133

56

 

HVSIccL

TGGCTTTATGTACTATGTAC

 
 

Tableau 3 : Amorces utilisées pour chaque fragment (Jehaes et al. 2001).

3.5. Vérification de PCR

Cette étape consiste tout simplement à vérifier que l'ADN a bien été amplifié en quantité suffisante. Pour cela, une électrophorèse est réalisée. En premier lieu, un gel d'agarose est fabriqué puis l'ADN y est incorporé par l'intermédiaire de puits. Du bleu de bromophénol est ajouté à l'ADN afin d'alourdir le mélange et de permettre de visualiser le front de migration. Un marqueur de taille est également déposé dans certains puits afin de servir d'échelle. Le gel, une fois chargé, est introduit dans l'électrophorèse ou il est immergé dans un tampon qui permettra la conduction du courant électrique. Une fois le courant établi les échantillons vont migrer différentiellement selon la taille et la charge des fragments d'ADN. Les petits fragments migreront plus vite que les gros qui seront ralentis dans les mailles du gel. Le gel est ensuite trempé dans du BET (bromure d'éthidium), intercalant qui permettra ensuite la révélation des bandes d'ADN sous UV. La taille des fragments est enfin estimée par comparaison au marqueur de poids moléculaire.

3.6. Clonage

Les échantillons pour lesquels on a obtenu un signal sont clonés. Cette étape de clonage permet de visualiser l'ensemble des séquences ADN présentes dans un même produit PCR, permettant ainsi de séparer les potentielles séquences contaminantes des séquences authentiques. En effet, comme nous l'avons vu précédemment, la PCR va préférentiellement amplifier l'ADN le plus abondant et le moins dégradé, ce qui n'est pas souvent compatible avec l'ADN ancien. La première étape de ce clonage est la ligation : elle permet l'insertion du fragment ADN d'intérêt dans la bactérie, par l'intermédiaire de vecteurs. Ces bactéries sont

ensuite mises en culture dans un milieu contenant de l'ampicilline, un antibiotique, puis mises à incuber. Seules les bactéries ayant inséré le fragment d'intérêt, sont résistantes à l'ampicilline et peuvent se développer. Une fois les colonies formées, celles-ci seront récupérées, formant ainsi un stock d'ADN. Afin de vérifier que les bactéries ont bien intégré le fragment de taille attendue, une PCR ainsi qu'une vérification sur gel d'agarose sont réalisées. Dans le cas d'un clonage réussi, les échantillons sont envoyés à séquencer (entreprise Co-genics), ce qui nous permettra d'obtenir la succession des bases des séquences d'intérêt.

3.7. Analyse des séquences

Après le retrait des vecteurs et des amorces des séquences, la première étape est l'alignement des séquences (clones, témoins, ADN des manipulateurs et fouilleurs, contaminations répertoriées au sein du laboratoire), à l'aide du logiciel Bioedit.

La comparaison directe des séquences entres elles ainsi qu'avec la séquence de référence d'Anderson va nous permettre de repérer les mutations sur les clones mais aussi de détecter les séquences contaminantes, les erreurs de réplication lors de la PCR et les phénomènes de déamination. Il est particulièrement important de comparer les séquences obtenues dans les témoins et les séquences des tubes contenant des extraits d'ADN ancien. En effet, Lorsque de l'ADN est retrouvé dans les témoins, celui-ci est issu de contamination provenant de plusieurs sources (réactifs d'extraction ou d'amplification, manipulateurs du laboratoire ou encore séquences étudiées précédemment dans le laboratoire). Par conséquent, toute séquence d'ADN ancien identique à une séquence retrouvée au sein des témoins sera considérée comme contamination.

Lorsqu'une séquence présentant des mutations est authentifiée, il est ensuite possible d'aller chercher des informations concernant ces mutations dans les bases de données du net (Blast NCB I, http://www.ncbi.nlm.nih.gov/): ont-elles été répertoriées, référencées, sont-elles caractéristiques d'un haplogroupe ? Ces informations sont acquises à partir du site http://www.stats.gla.ac.uk/~vincent/founder2000/ présentant une base de données de séquences mitochondriales obtenues pour un grand nombre de populations Européennes et proche-orientales (Richards 2000).

3.8. Typage des fouilleurs

Le typage des fouilleurs s'effectue de la même manière que les analyses réalisées sur de l'ADN actuel. Nous avons envoyé à chacun des fouilleurs un kit de prélèvement buccal afin de pouvoir récupérer l'ADN issu des cellules épithéliales de l'intérieur de la joue. En une journée, l'extraction, l'amplification et la vérification de la PCR sont réalisées.

Les étapes d'extraction et d'amplification ne s'effectuent pas en salle blanche car la quantité d'ADN, normalement assez abondante, permet à la PCR d'être insensible aux contaminations extérieures. Pour cette même raison, l'étape de clonage n'est pas non plus réalisée. L'étape d'extraction se trouve très réduite par rapport à celle effectuée en ADN ancien. La partie concernant le broyage des échantillons est bien sûr absente pour ces analyses ainsi que l'étape de purification. Les produits utilisés lors de l'extraction sont un peu différents de ceux retrouvés pour l'ADN ancien. Ceux-ci sont utilisés sous forme de kit ce qui réduit encore un peu le temps passé pour la réalisation de cette étape.

L'ADN étant normalement en très bon état il est alors inutile de fragmenter la région HVR1. En conséquence, les amorces utilisées pour la PCR vont amplifier toute cette région (voir tableau 4).

III Synthèse bibliographique

Les études génétiques de parenté sur de l'ADN ancien peuvent apporter des informations essentielles quant à l'organisation des sociétés et le mode de vie des populations du passé.

Dans le cas de résultats positifs, ces études permettent parfois de nous renseigner sur le statut de la famille au sein de la société, le fonctionnement marital (endogamie, exogamie) ou permet encore de déterminer si un système matrilocal ou patrilocal était adopté par ces populations.

Afin d'obtenir toutes ces informations, plusieurs marqueurs génétiques sont utilisés.

L'ADN mitochondrial (ADN mt) est presque toujours le premier marqueur analysé pour les raisons que nous avons énumérées précédemment. Il permet de repérer les liens maternels. Très souvent, lorsque des résultats sont obtenus à partir de l'ADN mt, des analyses sur les STR autosomaux sont réalisées. Les STR (short tandem repeat) sont de petites séquences de quelques paires de bases se répétant de manière variable au sein du génome nucléaire et présentant un polymorphisme important entre individus. Pour ces marqueurs, nous disposons chacun d'un allèle transmis par nos deux parents et il est donc possible de repérer des liens de parenté biparentaux à partir de la taille de ces STR. Le même concept est utilisé pour le chromosome Y et permet alors de déterminer uniquement les liens paternels.

Sur les chromosomes sexuels XY, les analyses peuvent également porter sur un marqueur spécifique du sexe : le gène de l'amélogénine, afin de confirmer le sexe morphologique de l'individu.

On recense actuellement très peu d'articles (moins d'une quinzaine) portant sur les liens de parenté génétiquement établis à partir d'ADN ancien.

Cette réalité résulte sûrement du fait que les études sur l'ADN ancien se heurtent à de nombreux obstacles (ADN dégradé, contaminations...) ne permettant pas d'aboutir à des résultats exploitables. Néanmoins, une grande majorité de ces études datent des années 2000, et l'on peut donc espérer qu'elles se multiplient dans un avenir proche grâce aux progrès méthodologiques qui seront réalisés quant à l'extraction et l'amplification de l'ADN.

Nous avons souhaité établir, dans le cadre de ce mémoire, un bref bilan (non exhaustif) des études paléogénétique de liens de parenté publiées à ce jour. Cette synthèse bibliographique présente plusieurs intérêts. Il s'agit en premier lieu de présenter le contexte

archéologique des sites étudiés ainsi que les motivations principales conduisant à ces études de liens de parenté. Quelles données importantes pourraient ressortir de ces liens de parenté établis génétiquement ? Les informations qui seront obtenues pourront-elles être généralisées à une population, une époque... ?

Elle permet ensuite de faire un point sur les techniques et protocoles utilisés pour effectuer ces analyses génétiques. Retrouve-t-on, de manière systématique dans ces études, toutes les précautions reconnues aujourd'hui comme essentielles à la conservation de l'ADN, à la limitation des contaminations ainsi qu'à la détection de celles-ci ?

Quels résultats génétiques, ces études obtiennent t'elles pour l'ADN mitochondrial et l'ADN nucléaire ? Peut-on faire un rapprochement entre les précautions prises et la qualité des résultats obtenus ?

Pour finir, qu'obtiennent ces études en terme de liens de parenté ? Et que peut-on en conclure ?

Neuf publications seront présentées dans le cadre de cette synthèse bibliographique non exhaustive : (Haak et al. 2008 (art n°2) ; Cappellini et al. 2003 (art n°4) ; Bouwman et al. 2008 (art n°3) ; Keyser-Tracqui et al. 2003 (art n°6) ; Dudar et al. 2003 (art n°9) ; Mooder et al. 2005 (art n°1) ; Rudbeck et al. 2005 (art n°7) ;.Clisson et al. 2002 (art n°5) ; Adachi et al. 2004 (art n°8) (tabl. 4 et 5).

IV Résultats

1. Résultats de la synthèse bibliographique

Le tableau ci-dessous (tabl .4) présente neuf publications portant sur liens de parenté, entre individus d'une même sépulture ou d'une même nécropole, établis génétiquement. Ce premier tableau détaille certains aspects techniques essentiels : les précautions prises lors de ces études ainsi que les résultats obtenus en termes de séquences authentiques d'ADN mt et nucléaire.

Le premier point à remarquer est que ces études portent sur des vestiges de toute époque et l'on constate que la qualité des résultats obtenus concernant l'ADN mitochondrial ne semble pas dépendre de l'âge des vestiges mais de leur milieu de conservation. Ce constat est d'ailleurs reconnu dans la littérature (Schultes 1999).

L'étude de Haak, (2008) est un parfait exemple de bonne conservation d'ADN sur des vestiges très anciens, puisque cette étude, menée sur de l'ADN datant de plus de 4000 ans, fournit malgré tout des résultats très satisfaisants pour l'ADN mt et l'ADN nucléaire.

Plus de la moitié des articles mentionnés dans ce tableau portent sur des vestiges retrouvés dans des milieux froids voir gelés (permafrost) et l'on constate aisément à partir des résultats que ces milieux sont idéaux à la conservation des vestiges et de l'ADN.

Parallèlement, ce tableau illustre assez bien les difficultés rencontrées aujourd'hui concernant l'analyse du génome nucléaire et cela même lorsque l'ADN mitochondrial sort relativement bien. Pour toutes les raisons énoncées précédemment, les marqueurs nucléaires sont en effet plus difficiles à obtenir que l'ADN mitochondrial. L'analyse des STR a été réalisée seulement dans six des ces études et quatre d'entre elles aboutissent à des résultats, globalement satisfaisants.

Malgré le caractère récent de ces publications, il convient de signaler que beaucoup d'entre elles ne respectent pas les protocoles conseillés et reconnus concernant la conservation de l'ADN, la détection de contamination et l'authentification des séquences.

Pour ce qui est de la conservation, plusieurs études méthodologiques ont montré que la mise en congélation immédiate des restes après leur prélèvement était une précaution essentielle afin de limiter la dégradation de l'ADN (Pruvost 2008). Ce protocole n'a

cependant pas toujours été respecté dans le cadre des ces études puisque seulement trois articles sur les neuf font mention de cette congélation immédiate des restes à -20°C.

Comme nous l'avons vu précédemment, le deuxième élément important dans les études portant sur l'ADN ancien est la détection des contaminations. Or, dans ce tableau, plus de la moitié des publications ne mentionne pas d'étape de clonage pour l'ADN mitochondrial, laissant ainsi planer un doute non négligeable sur l'authenticité des séquences obtenues. En effet, comme nous l'avons expliqué précédemment, le clonage est une étape clef de repérage d'éventuelles contaminations modernes. Sans elle, l'authentification des séquences obtenues peut être sérieusement remise en question.

Concernant l'ADN nucléaire, plusieurs extractions et amplifications sont nécessaires afin de permettre l'authentification des allèles obtenus. On estime que huit répétitions (donnant des résultats positifs) est un nombre tout à fait acceptable pour cela (Taberlet 1996). Dans les études précédentes, le nombre de répétitions pour les STR est assez variable et s'étale de deux à dix-huit en fonction des individus et des articles. Le pourcentage de résultats authentiques parmi ces répétitions est une information qui n'a pas pu être obtenue car non mentionnée dans les publications. Les résultats concernant le gène de l'Amélogénine ont été notés dans ce tableau. Ce marqueur permet de vérifier le sexe de l'individu et de s'assurer également de la présence d'ADN nucléaire. Dans une grande majorité des études, les résultats concernant ce marqueur sont meilleurs que ceux obtenus pour les STR autosomaux ce qui est pour le moins étrange.

On constate donc de manière générale dans ce tableau une certaine hétérogénéité entre les articles vis-à-vis des protocoles et précautions effectuées. Il nous montre néanmoins clairement que les précautions sont indispensables à une bonne analyse paléogénétique.

L'étude de Bouwamn (2008) illustre assez bien l'importance des précautions dans ce type d'analyses car les résultats obtenus dans cette étude sont assez décevants (seulement 18% d'ADN authentique pour l'ADN mt et 0% pour d'ADN nucléaire) et ceci pourrait s'expliquer entre autre par l'absence de précautions prises lors des prélèvements ainsi que l'absence de congélation immédiate des échantillons (fouille ancienne).

Qu'en est-il maintenant des résultats obtenus en termes de liens familiaux ?

Des liens de parenté entre individus regroupés ont été mis en évidence dans cinq de ces études (Haak et al. 2008 ; Cappellini et al. 2003 ; Keyser-Tracqui et al. 2003 ; Bouwamn et

al. 2008 ; Keyser-Tracqui et al. 2003 et Dudar et al. 2003) (tabl .5). Les regroupements familiaux retrouvés sont de deux sortes.

On distingue en premier lieu les regroupements familiaux mis en évidence au sein d'une même structure funéraire réduite de type sépulture plurielle, chambre mortuaire etc. On retrouve ce type de regroupement au sein du cimetière néolithique d'Eulau en Allemagne (Haak 2008) ainsi qu'au sein de la nécropole Etrusque de Monterozzi (Cappellini 2003). Bien que quelques milliers d'années séparent ces deux sociétés, dans les deux cas, des relations de parenté très proches, de type parents-enfants unissent les individus regroupés. Ces types de regroupement sont très informatifs puisqu'ils permettent de montrer l'importance que tiennent les liens biologiques dans ces sociétés. Ce type de regroupement est également retrouvé au sein de la tombe circulaire mycénienne (Bouwman 2008). En effet, une relation de type frère- soeur est retrouvée entre deux individus issus d'une même sépulture. Outre l'influence importante des liens biologiques, cette relation de parenté apporte une nouvelle information qui est le statut de la femme dans cette société. Ici, nous sommes face à une tombe royale ou seules quelques rares femmes sont inhumées. Les liens biologiques unissant ces deux individus attestent de l'autorité de cette femme, autorité acquise par droit de naissance et non par relation conjugale.

Le deuxième type de regroupement familial mis en évidence dans ces études est le regroupement intra sectoriel au sein de cimetière ou nécropole. Les études portant sur la nécropole antique de Gol Egyin en Mongolie (Keyser-Tracqui 2003) ainsi que le cimetière moderne de Harmony road au Canada (Dudar 2003) mettent en évidence des regroupements familiaux sectoriels. Dans le cas du cimetière de Harmony road, les liens maternels figurent sur deux générations d'inhumations ce qui laisse penser qu'un système de patrilocalité était adopté par ces pionniers canadiens. Pour ce qui est de la nécropole de Gol Egyin, quelques familles regroupées formant des secteurs dans la nécropole ont été identifiées mais quelques individus apparentés sont également retrouvés dispersés eu sein de celle-ci.

 

chronologie

N°art

conditions de prélèvements et de stockage. état
conservation des restes.

échantillon

régions étudiées

% de séq
authentiques

critères d'authentification.

Néolithique

ADN mt (HVR1)

Bonne conservation du reste dû au climat froid. Pas de 83% pas de clonage

7000 BP, Sibérie. 1 précautions lors des prélèvements ni de congélation. Fouille 37 individus ADN mt (SNP)

très ancienne. Amélogénine 75% concorde avec sexe morpho

ADN mt (HVR1) 75%

Clonage

ADN mt (HVR2) 22%

4600 BP, Allemagne. 2 Bonne conservation générale des restes. Prélèvements des

échantillons avec précautions puis congélation. 13 individus Amélogénine 75% concorde avec sexe morpho

STR autosomaux 45%

3 à 9 répétitions selon les individus

STR chrom Y 23%

ADN mt (HVR1)

18% Clonage

ADN mt (HVR2)

3500 BP, civilisation

Mycéenne, Grèce. 3 Fouilles des sépultures très anciennes, pas de précautions

prises lors des prélèvements ni de congélation 22 individus Amélogénine 0%

STR autosomaux 0%

STR chrom Y 0%

Antiquité

IVe- IIIe siècle av J.-C,
Italie.

4

Mauvaise conservation des restes. Pas de précautions lors
des prélèvements, ni congélation.

4 individus

ADN mt (HVR1)

100%

Clonage

Amélogénine

100%

concorde avec sexe morpho

STR autosomaux

0%

 

IIIe siècle av J.-C,
Kazakhstan.

5

Très bonne conservation dû au gel. Précautions prises lors
des prélèvements et congélation des échantillons.

2 individus

ADN mt (HVR1)

100%

pas de clonage

Amélogénine

100%

concorde avec sexe morpho

STR autosomaux

100%

15 répétitions

IIIe - IIe siècle av J.-C,
Mongolie.

6

Conservation des os moyenne. Pas de précautions lors des
prélèvements mais congélation des échantillons.

62 individus

ADN mt (n=56)

82%

pas de clonage

Amélogénine

100%

concorde avec sexe morpho

STR autosomaux

79%

18 répétitions

STR chrom Y (n= 35)

27%

18 répétitions

Moyen-Age

1000-1250 ap J.-C,
Danemark.

7

Précautions lors des prélèvements mais pas de congélation
des échantillons, stockage à température ambiante.

10 individus

ADN mt (HVR1)

90%

Clonage

ADN mt (reg codante)

90%

Clonage

Epoque
Moderne

XVIIIe - XIXe siècle
ap J.-C, Japon.

8

Pas de précautions lors des prélèvements ni congélation des
échantillons.

41 individus

ADN mt (HVR1)

73%

pas de clonage

ADN mt (HVR2)

n.d

pas de clonage

XIXe - XXe siècle ap
J.-C, Nord Canada.

9

Pas de précautions lors des prélèvements ni de congélation
des échantillons.

38 individus

ADN mt (HVR2)

60%

pas de clonage

Amélogénine

34%

concorde avec sexe morpho

STR autosomaux

47%

???


article

contexte archéologique et Problématique de l'étude.

résultats

discussion

1

Cimetière Néolithique de Lokomotiv, Lac Baïkal, Sibérie (7000 BP). Plus
grand cimetière Néolithique du nord asiatique. Grande variabilité dans les
pratiques funéraires (architecture des tombes, dépôt des défunts, traitement
des corps...). Cette variabilité indique t-elle une absence d'affinité biologique
entre les individus ?

Profil ADN mt de 31 individus sur 37. haplogroupe F dominant
à 70%. Haplogroupes ? de ceux d'aujourd'hui dans la région.
Existence de très peu de groupes matrilinéaire.

Les quelques liens matrilinéaire retrouvés n'ont pas façonné
l'organisation spatiale du cimetière, mais ils ont influencé le
type de tombe et dans certains cas le type de traitement
donné au défunt.

2

Cimetière d'Eulau (Allemagne), Néolithique (4600 BP). Découverte de 4
sépultures collectives regroupant adultes et enfants. Proximité entre
individus apparente. Individus sûrement victimes de mort violente. Approche
multidisciplinaire [archéologique, anthropologique, géochimique (isotope
radioactif) et paléogénétique] dans le cadre de l'étude. Analyses
géochimiques et paléogénétiques effectuées sur 13 individus regroupés dans
les 4 tombes.

Mise en évidence d'un noyau familial dans 2 des 4 tombes. Dans
l'une, père, mère, fils, fille. Dans la deuxième, 3 frères et soeurs
associés à une femme qui n'est pas leur mère. Présence
d'haplogroupe X2, I, K, H, J. Mort violente pour 5 individus sur
13. Les Isotopes du strontium montrent que les hommes et les
enfants mâles ont grandit dans la même région mais pas les
femmes.

Mise en évidence de l'importance des liens biologiques au
sein de l'organisation de cette société Danubienne
Néolithique. Système patrilocal et exogame adopté par ces
populations.

3

Tombe circulaire mycénienne, Grèce (3500 BP). Les preuves archéologiques
montrent que les 35 individus inhumés au sein de cette structure ont un statut
d'élite. Il est supposé que les groupes de sépulture représentent différentes
dynasties ou différents membres d'une même famille. Des reconstructions
faciales réalisées semblent départager les individus en trois groupes en
fonction de la forme de leur visage. Etude paléogénétique en vue de localiser
d'éventuels regroupements familiaux au sein de cette tombe.

Echec des analyses portant sur l'ADN nucléaire. Profil
mitochondrial obtenu pour 4 individus sur 22. Mise en évidence
d'une même lignée maternelle unissant deux individus, masculin
et féminin. Les deux individus apparentés étaient regroupés dans
la même catégorie de visage.

Les liens unissant ces deux individus pourraient être de type
frère - soeur. Les sujets féminins sont très rares au sein de
cette tombe. Ces femmes semblent disposer d'un statut
particulier au sein de la société. L'implication est que le
sujet féminin en question n'est pas inhumé dans cette tombe
pour cause de relation conjugale mais parce qu'elle a occupé
une position d'autorité par droit de naissance.

4

Nécropole de Monterozzi (Latium, Italie) (IVe-I I Ie siècle BC). Sépulture
collective de 4 individus retrouvés dans une chambre mortuaire étrusque [2?
(1 mature + 1 imamat) + 2 c' (1 mature + 1 imamat)]. S'agit-il d'un
regroupement familial?

Mise en évidente d'une même séquence HVRI chez la ? adulte
et les 2 immatures. STR non reproductibles.

Regroupement familial dans cette chambre mortuaire.
Présence d'une mère et ces deux enfants. L'homme adulte
pourrait être le père.

5

Tombe de prince Saka retrouvé dans un tumulus en pierre (Kazakhstan, IIIe
siècle BC). Sépulture double: 1 d' (30-35 ans), le prince ? Et 1 ? (+ 60 ans).
Liens de parenté proche entre les 2 individus?

Aucune lignée maternelle mise en évidence avec l'ADN mt.
Comparaison des STR ambigus mais surement aucun lien de
parenté.

Hypothèse d'un couple. Le prince et sa femme ?

6

Nécropole de Gol Egyin, Nord de la Mongolie (IIIe - IIe siècle BC, période
Xiongu). Découverte d'une centaine d'individus. Cimetière partagé en 4
secteurs. Sépulture simple pour une grande majorité mais quelques sépultures
double. Regroupement familial au sein des secteurs ainsi qu'au sein des
sépultures doubles?

49 profils génétiques obtenus. 27 individus typés pour le chromosome Y : 18 haplotypes ?. Profil mitochondrial de 46 individus sur 56. 89% d'haplogroupes asiatiques (A, C, D) et quelques haplogroupes européens. Présence de sépultures

doubles avec individus sans liens de parenté apparente.

Mise en évidence de liens familiaux maternels et paternels
au sein des secteurs majoritairement et intersecteur pour une
minorité. Plusieurs familles identifiées. Chronologie des
phases des secteurs établis à partir des résultats génétiques
et des datations.

7

Cimetière de Kongemarken, Danemark (1000-1250 AC). Un des plus vieux
cimetières paléochrétiens du Danemark. Ségrégation hommes-femmes. d'
inhumés au Sud du cimetière et ? au Nord. Cependant quelques d' avec les ?
au Nord et quelques ? avec les d' au Sud. Liens de parenté entre d' et ?
regroupés ? Analyses ADN effectuées sur 9 individus issus de 2 zones (1d' +
4 ? et 1 d' + 3 ?).

Aucune lignée matrilinéaire commune entre les individus.
Présence de 4 haplogroupes différents (U7, I, J, T2). Grande
diversité de la population inhumée. Haplogroupe U7 absent dans
la région actuellement et haplogroupe I très rare.

Ces observations suggèrent que les individus vivant dans la
région de Roskilde il ya 1000 ans ne sont pas tous membres
d'une population local mais composé de personnes ayant
des liens génétiques avec des populations beaucoup plus
lointaine (Sibérie, Inde...)

8

Site d'Hatanai, N-E Japon (XVIIIe- XIXe siècle, période Edo). Découverte de
45 individus. Sépultures simples. Mise en évidence de 3 cimetières majeurs. 1
cimetière regroupe des femmes et des enfants uniquement et un autre
regroupe des individus pathologiques. Regroupement familial au sein des
deux premiers cimetières?

ADN de 30 individus exploitable, 8 haplogroupes et 14 lignées
maternelles sont observées. Nombreuses lignées maternelles ?.

Différences généalogiques importantes dans ces cimetières,
peut-être dû à des effets de remplacement de la population
dû à des périodes de famine. Cimetières datant de 3
périodes différentes.

9

Cimetière de Harmony road, Nord du Canada (XIXe- XXe siècle). Mise en
évidence de 3 périodes d'inhumation distinctes dans le cimetière. Analyse
génétique de lien de parenté entre individus effectuée sur 28 individus.

Utilisation du cimetière sur 1 ou 2 générations. Aucune preuve
de liens de parenté établie mais certains haplogroupes sont
retrouvés regroupés dans une même zone. Les STR ne
renseignent pas.

Diversité de l'ADN mt dû à la mobilité et aux migrations
au XIXe siècle. L'ADN mt démontre des haplotypes
matrilinéaire figurant pour deux générations
d'Inhumations, suivie de remplacement par de nouvelles
lignées : ceci suggère un système patrilinéaire / patrilocal
adopté par ces pionniers du nord du Canada.

Tableau 5 : Synthèse bibliographique des résultats d'études paléogénétique de liens de parenté.

2. Résultats des analyses génétiques

2.1. Les fouilleurs

Le tableau ci-dessous (tabl.6) présente les séquences HVSI des fouilleurs. Ces séquences ont été systématiquement confrontées à celles obtenues sur les échantillons anciens.

 

fragment A

fragment B

fragment C

fragment CC

Fouilleur 1

0

0

0

0

Fouilleur 2

0

0

0

16362 TC.

Fouilleur 3

16079 CA, 16085 CG.

0

0

16298 TC.

Fouilleur 4

16126 TC.

0

0

0

Fouilleur 5

16147 CA, 16172 TC.

16217 AG, 16223 CT,
16248 CT.

16320 CT.

16355 CT.

Tableau 6 : Mutations présentes sur la région HVS1 des fouilleurs.

2.2. Les séquences des individus

Dans le cadre de cette étude de faisabilité, une seule extraction par individu a été réalisée. La majorité des fragments n'a été amplifiée qu'une seule fois, cependant une deuxième PCR a été effectuée dans certains cas problématiques.

Le tableau ci-dessous (tabl .7) présente le nombre d'amplifications réalisées ainsi que le nombre de clones obtenus pour chaque fragment et chaque individu. Le tableau 8 présente le détail des mutations observables sur chacun des clones obtenus.

 
 

Nombre de clones obtenus

 
 

HVSIA

HVSIB

HVSIC

HVSICC

Sep 169

1er inhumé

6 (1)

6 (1)

6 (1)

 

2ème inhumé

 

13 (3)

3 (1)

 

3ème inhumé

6 (1)

 
 

6 (1)

Sep 170

1er inhumé

7 (2)

6 (1)

6 (1)

 

2ème inhumé

 

6 (1)

3 (1)

3 (1)

3ème inhumé

 
 
 

6 (2)

sep 171

1er inhumé

3 (1)

3 (1)

3 (1)

 

2ème inhumé

 

6 (1)

 

6 (1)

3ème inhumé

 

2 (1)

 

3 (1)

Tableau 7 : Clones obtenus pour chaque fragments et individus.

Les chiffres entre parenthèses correspondent au nombre de PCR réalisées.

Avant toute chose il convient de signaler que les clones obtenus présentent, pour une grande majorité, des cas de déamination. Ce phénomène de dégradation de l'ADN, très fréquent sur l'ADN ancien, est une réaction chimique d'hydrolyse des acides nucléiques. Ces « fausses » mutations sont relativement repérables et nous ne les énumérerons donc pas dans cette partie.

Sep 169

- 1er inhumé :

Des séquences ont été obtenues pour les fragments A, B et C.

Pour le fragment A, les mutations 16069 CT et 16126 TC sont retrouvées sur les six clones obtenus. Lors de ces analyses, aucun des témoins n'a rendu de séquences contaminantes sur ce fragment. La mutation 16126 TC est également retrouvée chez un fouilleur ainsi qu'au sein de séquences répertoriées au laboratoire comme potentiellement contaminante. Néanmoins, l'association des deux mutations n'est retrouvée nulle part. Au vu des résultats dont nous disposons, les séquences présentant les mutations 16069 CT et 16126 TC semblent donc authentiques. Toutefois, une deuxième PCR serait nécessaire afin de le confirmer.

Les séquences obtenues pour le fragment B ne présentent aucune mutation récurrente. Il s'agit donc de la séquence de référence. Les séquences d'Anderson obtenues ne peuvent pas être authentifiées car des contaminations provenant de fouilleurs, de manipulateurs et autres ne peuvent pas être exclus. Néanmoins l'individu pourrait tout à fait présenter une séquence d'Anderson pour ce fragment.

En ce qui concerne le fragment C, on constate la récurrence de la mutation 16300 AG chez cinq clones sur six. Cette mutation n'est retrouvée ni dans les témoins, ni chez les fouilleurs et manipulateurs et n'est pas non plus observée au sein des séquences répertoriées au laboratoire comme potentiellement contaminantes. Par conséquent, celle-ci est sans doute authentique. Toutefois, là aussi, une deuxième PCR serait nécessaire pour l'authentification.

En recherchant dans les bases de données, l'association des trois mutations 16069 CT, 16126 TC et 16300 AG est connue et nous renvoie à l'haplogroupe J. Le blast de l'association des trois fragments consensus (mutations 16069 CT, 16126 TC et 16300 AG) est réalisé et nous renvoie à une seule séquence homologue à celle-ci, séquence retrouvée dans une étude encore non publiée (sans info sur la provenance géographique ?!).

- 2ème inhumé :

Pour cet individu, des séquences ont été obtenues seulement pour les fragments B et C.

Pour le fragment B, deux PCR ont été réalisées. La première amplification ne présente aucune mutation pour huit séquences sur neuf. Il s'agit donc de la séquence de référence. Malgré le nombre important de clones, ces séquences d'Anderson ne peuvent pas être authentifiées car nous ne pouvons pas écarter un phénomène de contamination. La deuxième amplification donne des séquences différentes. Les trois clones obtenus présentent la mutation 16223 CT. Cette même séquence a été retrouvée au sein des témoins de cette PCR ; celle-ci est donc potentiellement une contamination.

L'analyse du fragment C, nous fournit des séquences d'Anderson pour les trois seuls clones obtenus. Là aussi, les contaminations ne peuvent pas être exclues mais il se pourrait également que l'individu ne possède pas de mutation sur ce fragment. Ces séquences ne peuvent donc pas être authentifiées.

En conclusion, aucune des séquences obtenues pour cet individu ne peut être authentifiée. - 3ème inhumé :

Des clones sont obtenues pour les fragments A et CC.

Les séquences du fragment A fournissent trois mutations récurrentes. On observe ainsi les mutations 16069 CT, 16093 TC et 16126 TC chez trois clones ainsi que la mutation 16037 AG sur 2 clones. Les trois premières mutations sont répertoriées et retrouvées fréquemment mais la mutation 16037 AG est totalement inconnue. Les témoins réalisés pour ce fragment ne fournissent aucune séquence contaminante. De plus, cette association n'est retrouvée ni dans les séquences répertoriées au laboratoire comme pouvant être contaminante ni dans les séquences des fouilleurs et manipulateurs. Il est alors tout à fait possible que les séquences présentant les mutations 16069 CT, 16093 TC et 16126 TC soient endogènes. Toutefois, une seconde PCR serait nécessaire afin de confirmer ce résultat.

Les séquences obtenues pour le fragment CC, nous montrent la présence d'une mutation présente chez trois clones sur 6. Cette mutation 16298 TC a déjà été rencontrée au sein de témoins aérosol dans le cadre de cette étude mais non au sein des témoins propres à cette PCR. Malgré cela, il n'est pas possible d'authentifier cette séquence car il peut tout à fait

s'agir d'une contamination. Un des fouilleurs présente également cette unique mutation sur le fragment CC. Une contamination par l'ADN de cet individu ne peut donc pas être exclue. Cependant les autres mutations présentes chez cet individu ne sont retrouvées nulle part. On observe également la présence d'une mutation isolée 16258 AG sur un seul clone. Cette mutation est issue de contamination puisque retrouvée au sein des témoins extraction de cette PCR.

L'association des mutations 16069 CT, 16093 TC et 16126 TC a déjà été répertoriée. Celle-ci renvoie à l'haplogroupe J. Il s'agit toutefois d'un haplotype différent de celui rencontré précédemment. Le blast le la séquence comportant les mutations 16069 CT, 16093 TC et 16126 TC nous renvoie à plusieurs études non publiées dans lesquelles des séquences homologues à 100% sont retrouvées. D'après les titres de ces articles on constate que cet ensemble de mutation est plus particulièrement retrouvé dans le nord de l'Europe ainsi qu'en Hongrie.

Sep 170

- 1er inhumé.

Des séquences ont été obtenues pour les fragments A, B et C.

Le fragment A a été amplifié deux fois. Il ne fournit que des séquences d'Anderson sur les 7 clones analysés. Ces séquences peuvent être des contaminations mais cet individu pourrait tout aussi bien ne présenter aucune mutation sur ce fragment. Ces séquences ne peuvent donc pas être authentifiées dans le cadre de cette étude de faisabilité.

Le fragment B fournit des clones présentant un nombre important de mutations. La plupart de ces mutations ne sont pas récurrentes et résultent essentiellement de phénomène de déamination. La mutation 16224 TC semble néanmoins authentique car présente chez cinq clones sur six et absente des témoins et des séquences potentiellement contaminantes (séquences répertoriées au laboratoire, séquences des fouilleurs et manipulateurs).

La mutation 16224 TC est également retrouvée sur le fragment C chez six clones sur six. Ceci confirme l'authenticité de cette mutation

En recherchant dans les bases de données, la mutation 16224 TC nous renvoie aux haplogroupes H ou K. Dans les deux cas, ces haplogroupes sont originaires d'Europe de l'Ouest.

Le blast des séquences nous renvoie à un grand nombre d'articles dans lesquels sont répertoriés des séquences identiques présentant uniquement cette mutation 16224 TC.

- 2ème inhumé :

Des clones ont été obtenus pour les fragments B, C et CC.

Le fragment B est sans ambigüité ; la mutation 16224 TC retrouvée chez le premier inhumé est également présente chez cet individu. La présence de cette mutation chez cinq clones sur cinq ainsi que son absence des témoins et des séquences répertoriées comme potentiellement contaminantes permet d'authentifier cette mutation.

On constate la présence d'une mutation 16220 AG très récurrente au sein des témoins. Cette séquence est donc à rajouter aux séquences contaminantes du laboratoire.

Le fragment C confirme le caractère authentique et endogène de la mutation 16224 TC. Cette mutation est retrouvée sur les trois clones obtenus. Trois mutations successives sont également observées dans la zone (16374-16376) mais celles-ci sont surement dues au dérapage de la Taq polymérease au niveau du poly C situé à cet endroit.

Les témoins montrent trois séquences présentant une nouvelle mutation : 16298 TC. Cette séquence est à ajouter comme issue de contamination.

Le fragment CC atteste définitivement du caractère endogène de la mutation 16224 TC car celle-ci est présente sur les trois clones obtenus pour ce fragment. Aucune autre mutation n'est présente sur ces séquences.

Tout comme pour le 1er inhumé, la recherche de cette mutation fournit les haplogroupes H ou K. De la même façon, le blast nous apprend que de nombreuses séquences présentant cette unique mutation sont retrouvées au sein d'étude de génétique portant sur des populations européennes.

- 3ème inhumé :

Des séquences ont pu être obtenues seulement sur le fragment CC. Deux amplifications ont été réalisées.

La première amplification fournit trois clones sur lesquels sont observés uniquement des séquences d'Anderson. La deuxième fournit le même résultat.

Malgré les deux répétitions réalisées sur ce fragment, ces séquences ne peuvent pas être authentifiées car peuvent tout à fait être issues de contaminations (séquence retrouvée de

façon récurrente comme contaminante) vu le mauvais état de conservation de l'ADN de cet individu.

Sep 171

- 1er inhumé :

Pour cet individu, des séquences ont été obtenues pour les fragments A, B et C.

Le fragment A comporte une seule mutation présente une seule fois sur les 3 clones. Cette mutation non répertoriées est sans doute le résultat d'un phénomène de déamination.

Le fragment B comporte trois mutations récurrentes en position 16183 AC, 16189 TC et 16223 CT sur les trois clones obtenus. Ces séquences pourraient être considérées comme contaminantes car les mutations 16189 TC et 16223 CT sont retrouvées dans les séquences potentiellement contaminantes du labo. Elles sont néanmoins absentes des témoins.

Le fragment C comporte également la mutation 16223 CT vu sur le fragment B. S'ajoute à celle-ci la mutation 16278 CT présente chez trois clones sur trois. L'association de ces deux mutations n'est pas retrouvée au sein des témoins ni des séquences potentiellement contaminantes (manipulateurs, fouilleurs)

Lorsque que l'on recherche dans les bases de données l'association des mutations 16189 TC, 16223 CT et 16278 CT, celle-ci nous renvois à un haplogroupe bien définis, l'haplogroupe X. Le blast d'une séquence comprenant les mutations 16189 TC, 16223 CT et 16278 CT, nous renvoie à un grand nombre d'articles dans lesquels sont figurés des séquences similaires d'haplogroupe X. Ces publications ne seront pas énumérées car les séquences qui y sont répertoriées sont issues d'origines géographiques différentes.

- 2ème inhumé :

Pour cet individu, des clones ont été obtenus pour les fragments B et CC.

Le fragment B comprend six clones présentant tous la même mutation 16223 CT. Aucune autre mutation n'est observée sur ces clones.

Le fragment C présente également la mutation 16223 CT chez 3 clones sur 6. Malheureusement cette unique mutation est retrouvée parmi les témoins PCR de cette amplification.

Les séquences obtenues pour cet individu ne semblent pas être authentiques ou du moins il n'est pas possible de le prouver à ce stade des analyses.

- 3ème inhumé :

Des séquences ont été obtenues seulement pour les fragments B et CC.

Pour le fragment B, seul deux clones ont été récupérés. Ces deux clones présentent la mutation 16223 CT retrouvée également chez le deuxième inhumé de ce même sarcophage. Aucune autre mutation n'est observée sur ces clones. Cette mutation retrouvée également chez les témoins ne peut pas être authentifié sur cet individu comme sur le précédent. Toutefois, les résultats obtenus pour ces deux individus ne sont pas tous issus d'une même amplification et il paraît donc assez difficile à ce stade d'affirmer avec certitude que cette mutation est issue d'une contamination. Ces individus pourraient éventuellement partager cette mutation mais ceci serait à vérifier par des analyses complémentaires.

Cependant, le fragment C indique tout autre chose. La mutation 16223 CT n'est pas retrouvée sur ce fragment la mais on observe à la place l'association des mutations 16222 CT et 16261 CT sur trois clones.

Cette association de mutation n'est pas retrouvée dans les séquences potentiellement contaminantes (témoins, séquences des fouilleurs et manipulateurs, séquences du labo). Ces séquences sont donc peut être authentiques. De la même façon que pour les séquences précédentes, des analyses complémentaires sont nécessaires afin de confirmer cela.

L'association des deux mutations 16222 CT et 16261 CT donne l' haplogroupe H retrouvé dans le Nord-Ouest de l'Europe. Celles-ci sont également retrouvées associé aux mutations 16069, 16126, 16145 et forme l'haplogroupe J1b1 retrouvé en Grande-Bretagne, Irlande et Scandinavie. Le blast des séquences du fragment C comportant ces deux mutations nous renvoie à un grand nombre d'articles portant sur des origines géographiques très variées. Ces études ne seront donc pas énoncées.


sép

 
 

HVSIa

HVSIb (1 61 59-16236)

HVSIc

HVSIcc

169

 

extrait

tube

nb
clones

mutations

Tube

nb
clones

mutations

tube

nb
clones

mutations

tube

nb
clones

mutations

1er
inhumé

T118

A1

3

2 séq 16069 CT, 16126 TC
; 1 séq 16069 CT, 16089
GA, 16126 TC, 16129 GA,
16130 GA.

A1

3

3 séq Anderson.

B1

3

1 séq 16300 AG; 1 séq 16260
CT, 16282 CT, 16300 AG
; 1 séq
16294 CT, 16304 TC, 16362
TC.

 
 
 
 

A2

3

1 séq 16034 GA, 16069
CT, 16126 TC ; 2 séq
16069 CT, 16126 TC,
16142 CT
.

A2

3

1 séq 16204 GA; 2 séq
Anderson.

B2

3

1 séq 16300 AG; 1 séq 16300
AG, 16390 GA
; 1 séq 16250
CA, 16300 AG, 16336 GA.

 
 
 

2ème
inhumé

T122

 
 
 

B1

3

2 séq 16179 CT, 16186
CT; 1 séq Anderson.

C1

3

3 séq Anderson.

 
 
 
 
 
 
 

B2

3

1 séq 16187 CT; 1 séq
16179 CT, 16186 CT
; 1
séq Anderson.

 
 
 
 
 
 
 
 
 
 
 

B7

3

3 micro séq.

 
 
 
 
 
 

3ème
inhumé

T130

A11

3

3 séq d'Anderson

 
 
 
 
 
 

A12

3

3 séq 16298 TC.

 
 

A13

3

2 séq 16037 AG, 16069
CT, 16093 TC, 16126 TC ;
1 séq 16069 CT, 16093 TC,
16126 TC.

 
 
 
 
 
 

A13

2

1 séq d'Anderson ;
1 séq 16258 AG.

170

1er
inhumé

T119

A3

3

3 séq d'Anderson

A4

3

1 séq 16224 TC; 1 séq
16179 CT, 16184 CT,
16190 CT, 16197 CT,
16201 CT, 16211 CT,
16224 TC
; 1 séq 16168
CT, 16184 CT, 16190
CT, 16191 CT, 16193
CT.

B4

3

1 séq 16221 CT, 16224 TC;
1 séq 16224 TC, 16266 CT;

1 séq 16221 CT, 16224 TC,
16266 CT.

 
 
 
 
 
 
 

A5

3

2 séq 16224 TC; 1 séq
16196 GA, 16213 GA,
16224 TC
.

B5

3

2 séq 16224 TC; 1 séq 16224
TC, 16286 CT, 16287 CT,
16291 CT
.

 
 
 

2ème
inhumé

T123

 
 
 

B2

2

1 séq 16224 TC ; 1 séq
16204 GA, 16208 GA,
16224 TC, 16227 AG.

C3

3

3 séq 16224 TC, 16375 CT,
16376 CT, 16377 CT.

D1

3

3 séq 16224 TC.

 
 
 
 
 
 

B3

3

1 séq 16224 TC ; 1 séq
16179 CT, 16224 TC ; 1
séq 16193 CT, 16201
CT, 16222 CT, 16225
CT, 16232 CT.

 
 
 
 
 
 

3ème
inhumé

T124

 
 
 
 
 
 
 
 
 

D6

3

3 séq d'Anderson

 
 
 
 
 
 
 
 
 
 
 

A12

3

3 séq d'Anderson

171

1er
inhumé

T120

A13

3

2 séq d'Anderson ; 1 séq
16071 CT.

A7

3

1 séq 16167 CA, 16173
CT, 16183 AC, 16189
insertion A, insertion C
en 16194, 16189 TC,
16223 CT
; 1 séq 16183
AC, 16189 TC, insertion
c en 16194 16223 CT; 1
séq 16175 AC, 16183
AC, 16189 TC, 16223
CT.

B9

3

3 séq 16223 CT, 16278 CT.

 
 
 
 
 
 
 
 

A 8

5

1 séq 16183 AC, 16185 CT, 16191 CT, insertion C en 16194, 16223 CT ; 1 séq 16183 AC, 16190 CT, 16191 CT, 16193

CT, insertion C en

16194, 16223 CT,
16324 CT; 3 micro séq

 
 
 
 
 
 

2ème
inhumé

T131

 
 
 

B9

3

3 séq 16223 CT

 
 
 

A16

4

3 séq 16223 CT; 1 séq
16216 AG, 16220 AG.

 
 
 
 
 

B10

3

3 séq 16223 CT

 
 
 

A17

3

2 séq d'Anderson

3ème
inhumé

T132

 
 
 

B12

2

2 séq 16223 CT

 
 
 

A20

3

2 séq 16222CT, 16261
CT; 1 séq 16261 CT.

 
 
 
 
 
 
 
 
 
 
 

A21

3

3 séq d'Anderson

Tableau 8 : Détail des mutations présentes sur tous les clones obtenus.

2.3. Synthèse des résultats

Le tableau ci-dessous (tabl.9) présente les séquences endogènes de ces individus à ce stade des analyses. Ces séquences ont été authentifiées suivant plusieurs critères.

- La mutation ou l'ensemble des mutations présentes sur ces séquences

n'a pas été retrouvée parmi les témoins ni au sein des séquences des manipulateurs et fouilleurs. Elle n'a pas non plus été retrouvée parmi les séquences répertoriées au laboratoire comme potentiellement contaminantes.

- Ces mutations étaient répétées sur un minimum de deux ou trois clones issus d'une même PCR ou de PCR différentes, sur un même fragment ou sur des fragments différents.

 
 

Séquences consensus

 
 
 

HVSIA

HVSIB

HVSIC

HVSICC

Sep 169

1er inhumé

16069 CT, 16126 TC.

Contam ?

16300 AG

n.d

2ème inhumé

n.d

Contam ?

Contam ?

n.d

3ème inhumé

16069 CT, 16093 TC,
16126 TC.

n.d

n.d

Contam ?

Sep 170

1er inhumé

Contam ?

16224 TC

16224 TC

n.d

2ème inhumé

n.d

16224 TC

16224 TC

16224 TC

3ème inhumé

n.d

n.d

n.d

Contam ?

Sep 171

1er inhumé

n.d

16183 AC ?, 16189 TC,
16223 CT.

16223 CT, 16278 CT

n.d

2ème inhumé

n.d

16223 CT ?

16223?

n.d

3ème inhumé

n.d

?

n.d

16222 CT, 16261 CT ?

Tableau 9 : Mutations authentiques présentes sur chaque fragment des individus.

n.d = non déterminé. Cases vertes : séquences authentifiées ; cases roses : doutes sur l'authenticité des séquences.

V Discussion

Dans cette partie, nous nous attarderons tout d'abord sur les aspects techniques (authenticité et conservation de l'ADN) qui étaient les principaux objectifs de cette étude de faisabilité. Nous apporterons par la suite quelques résultats en termes de relation de parenté maternelle entre les individus étudiés.

1. Authenticité des séquences : conservation de l'ADN et contaminations - Conservation de l'ADN sur le site de Jau-Dignac :

Au vue des résultats que nous obtenons, la conservation de l'ADN des individus analysés apparaît très satisfaisante. Les résultats génétiques obtenus sont toutefois fragmentaires (tabl.9). Les neufs individus exhumés présentaient un état de conservation macroscopique relativement bon. Cette dernière information conforte bien l'idée qu'il existe une corrélation entre la conservation macroscopique des restes et leur conservation moléculaire, comme cela a été décrit dans la littérature (Cipollaro et al. 1998).

Le caractère récent des prélèvements ainsi que la mise en congélation immédiate des échantillons à - 20°C sont deux facteurs qui ont dû jouer un rôle important de frein à la dégradation de l'ADN des individus ; ceci pourrait entre autre expliquer la qualité des résultats obtenus. En effet, il a été démontré dans la littérature qu'il est préférable d'analyser un échantillon juste après son prélèvement sinon les processus de dégradation se remettent en route (Pruvost et al. 2008). La congélation des échantillons s'avère également être une précaution essentielle aux analyses paléogénétiques puisque celle-ci permet de limiter voir stopper la dégradation de l'ADN (Barriel 1997). Cette mesure, reconnue depuis longtemps en médecine légale, n'est cependant pas souvent prise lors d'études portant sur l'ADN ancien. En effet, comme nous l'avons vu dans la synthèse bibliographique, les études de (Cappellini et al. 2003 ; Dudar et al. 2003 ; Rudbeck et al. 2005 ; Adachi et al. 2004) portent sur des vestiges récemment fouillés mais qui n'ont pas été mis en congélation des leurs prélèvements.

Les études portant sur des échantillons prélevés anciennement comme les articles de Bouwman et al. (2008) et Mooder et al. (2005) n'ont malheureusement pas non plus bénéficié de cette précaution, ce qui est encore plus regrettable.

L'état de conservation de l'ADN est souvent associé à un autre phénomène qui est la contamination des échantillons par de l'ADN moderne. En effet, plus l'ADN est dégradé plus

les contaminations exogènes présentes apparaîtront lors des résultats. Il convient donc, afin de réaliser des analyses correctes, d'éviter au maximum ces phénomènes de contamination mais également de pouvoir les repérer.

- Contamination des échantillons

Comme nous l'avons dit précédemment, les prélèvements de mandibule n'ont pas tous été réalisés dans les mêmes conditions.

La sépulture 170 est la seule à avoir bénéficié de précautions particulièrement rigoureuses (port de gant, charlotte, mise en sachet puis congélation immédiate). Les deux autres sépultures, quant à elles, n'ont pas fait l'objet de port de gants. Toutefois, les autres précautions ont été prises.

L'analyse de la séquence du fouilleur n°2 (seul individu ayant prélevé les échantillons des sépultures 169 et 171) nous permet d'affirmer que cet individu n'a pas contaminé les échantillons. En effet, son unique mutation en position 16362 n'a jamais été retrouvée seule dans le cadre de cette étude. Les quatre autres fouilleurs, qui n'ont jamais été en contact direct avec les échantillons, présentent également des séquences absentes des analyses, ils n'ont donc pas contaminé les échantillons. En conséquence, l'absence de port de gant lors des prélèvements des sépultures 169 et 171 n'a eu aucune conséquence sur les résultats de ces analyses et le fait de manipuler mains nues, de façon brève, un échantillon ne s'avère pas un geste contaminant. Cette information confirme que la manipulation des échantillons à mains nues n'est pas le geste le plus contaminant, comme précédemment évoqué dans la littérature (Yang et al. 2005 ; Deguilloux et al. 2009). Cependant, il convient de signaler que les extractions ADN ont été réalisées à partir d'échantillons très particuliers (dents intactes en place) et que cette information ne sera peut-être pas valable pour des prélèvements d'os (Deguilloux et al. 2009).

Les contaminations observées lors de nos analyses sont alors issues d'autres sources (réactifs, séquences préalablement analysées au laboratoire, manipulateurs du laboratoire).

La séquence associant les mutations 16223 CT, 16256 CT et 16270 retrouvées dans les derniers témoins a été identifiée et répertoriée au labo comme contaminante des réactifs PCR. D'autres contaminations de ce type (précédemment répertoriées) n'ont pas été mises en évidence. Aucune contamination via les manipulateurs du laboratoire n'a été détectée.

Deux séquences comprenant, la mutation 16220 AG pour l'une et la mutation 16258 AG pour l'autre, ont été retrouvées dans plusieurs témoins. Selon les études menées au labo, ces

contaminants proviendraient des lots de primers. Enfin, la séquence comportant la mutation 16298 TC observée dans les témoins aérosol est également à répertorier comme séquence contaminante retrouvée au sein du laboratoire.

Comme nous l'avons montré dans le chapitre synthèse bibliographique, beaucoup d'études publiées portant sur l'ADN ancien ne respectent pas toutes les précautions nécessaires afin de limiter au maximum la dégradation de l'ADN ainsi que les contaminations par de l'ADN moderne (précautions lors des prélèvements, congélation des échantillons, multiples témoins, répétitions dans quelques cas, clonage). Toutes ces mesures ont été prises dans le cadre de cette étude de faisabilité ce qui explique sans doute la qualité des résultats obtenus.

Pour résumer, l'ADN mitochondrial semble globalement bien conservé et aucune contamination par des fouilleurs et manipulateurs n'a été mise en évidence. Par conséquent, des analyses complémentaires peuvent être envisagées. Dans un premier temps, les résultats obtenus dans le cadre de cette étude de faisabilité devront être authentifiés par des répétitions (autres extractions et amplifications). Si ces nouvelles analyses s'avèrent fructueuses, nous pourrons nous tourner vers l'ADN nucléaire avec l'analyse des STR. Comme nous l'avons dit précédemment, ces marqueurs permettront d'identifier des relations paternelles et de type parent-enfant.

2. Haplogroupes retrouvés

Ces analyses préliminaires ont permis de caractériser deux haplogroupes européens différents J et X chez trois individus au moins. La mise en évidence de mutations diagnostiques dans ces séquences anciennes nous laisse confiants quant à l'attribution de ces haplogroupes.

Pour deux individus (présentant la même séquence), il n'a pas été possible de préciser l'haplogroupe à partir des séquences HVRI seules, mais il pourrait s'agir de l'haplogroupe H ou K, tous deux européens.

- L'haplogroupe J

La sépulture 169 présente deux individus d'haplogroupe J mais d'haplotypes différents.

Celui-ci pourrait également être présent chez le 3ème inhumé de la sépulture 171 mais des analyses complémentaires des fragments A et B seraient nécessaires afin de le confirmer.

Cet haplogroupe J serait apparu au Moyen Orient il y a environ 45 000 ans. Il serait aujourd'hui majoritairement européen. Le graphique ci-dessous (fig.10) présente les fréquences de cet haplogroupe retrouvées en Europe de nos jours (Logan 2009).

Figure 10 : Fréquence actuelle de l'haplogroupe J en Europe d'après Logan (2009).

Une étude phylogéographique menée en France montre que l'haplogroupe J serait aujourd'hui essentiellement retrouvé à l'Ouest. La fréquence la plus importante de celui-ci serait observée en Bretagne (Finistère) avec 9%. On le retrouverait également en Centre Ouest (Corrèze, Dordogne), ou il serait un peu moins présent, avec une fréquence de 4% (Dubut 2004). Il convient toutefois d'ajouter que les estimations de cette étude sont très limitées du fait du très faible échantillonnage réalisé, concernant seulement 3 régions françaises et 50 individus, ces informations sont donc à prendre avec précautions.

Le blast de séquences endogènes obtenues pour le troisième individu nous renvoie à plusieurs études dans lesquelles sont retrouvées des séquences homologues à 100%. Ces séquences sont retrouvées en Europe du Nord (Royaume-Uni, Islande) ainsi qu'en Hongrie.

- Haplogroupe H ou K ?

La mutation 16224 TC retrouvée chez les deux premiers inhumés de la sépulture 170 renvoie aux deux haplogroupes K et H qui sont tous deux majoritairement observés en Europe de l'Ouest et du Nord (Richards 2000). En Europe, l'haplogroupe K, apparu il y a environ 50 000 ans, est majoritairement présent en Scandinavie. En France, celui-ci est plus particulièrement observé en Bretagne ainsi qu'en Centre-Ouest (Dubut 2004). Cependant, là

aussi ces estimations sont limitées par le faible échantillon concerné. L'haplogroupe H, quant à lui, est l'haplogroupe le plus présent en Europe actuellement avec une fréquence variant de 35 à 55 % suivant les pays et les régions (Richards 2000).

- L'haplogroupe X

L'haplogroupe X retrouvé chez le 1er inhumé de la sépulture 171 est un haplogroupe assez rare mais présent dans beaucoup de région du monde. L'haplogroupe X dans son ensemble représente environ 2 % de la population d'Europe, du Proche-Orient et d'Afrique du Nord. Le sous-groupe X2, spécifiquement européen et à priori absent de la majeure partie de l'Asie continental mais se retrouve également parmi les cinq haplogroupes majeurs des populations indigènes d'Amérique. Le graphique ci-dessous présente la fréquence de cet haplogroupe en Europe (fig.11) (Logan 2009).

Figure 11 : Fréquence de l'haplogroupe X en Europe d'après Logan (2009).

En France, l'haplogroupe X est uniquement présent dans le Nord (Bretagne et Nord-Pas de calais) à une fréquence d'environ 0,4% (Dubut 2004). Ces estimations se basent sur un échantillon très réduit, elles n'ont donc qu'une valeur indicative et très approximative.

Les mutations présentes chez le 1er inhumé du sarcophage 171 ne permettent pas d'obtenir un haplotype précis car celles-ci sont présentes au sein des deux sous groupes X1 et X2. D'autres régions de l'ADN mt seraient nécessaires afin de pouvoir acquérir cette information.

- Cas des deux derniers inhumés de la sépulture 171

La détermination d'haplogroupe chez les deux derniers inhumés de la sépulture 171 n'a pas été possible. Comme nous l'avons dit précédemment, l'hypothèse selon laquelle le dernier inhumé de ce sarcophage serait d'haplogroupe J1B1 par l'association des mutations 16069 CT, 16126 TC, 16145 CT, 16222 CT et 16261 CT serait également envisageable. On resterait alors dans une continuité d'haplogroupe J. Des analyses complémentaires portant sur les fragments A et B seraient nécessaires afin de clarifier cela.

En résumé, nous obtenons dans le cadre de cette étude, des haplogroupes s'intégrant parfaitement dans le pool génétique européen, peut-être plus particulièrement du Nord-ouest du continent. Ceci paraît donc tout à fait logique et attendu et cela pourrait être un argument supplémentaire d'authenticité des séquences obtenues.

3. Liens de parentés

Comme nous l'avons dit précédemment, les séquences obtenues pour les deux premiers inhumés de la sépulture 170 paraissent authentiques. On observe l'unique mutation 16224 TC chez ces deux individus sur deux ou trois fragments. On peut donc d'ores et déjà penser que ces deux individus sont apparentés du coté maternel.

Cependant, la similitude génétique de ces deux individus pourrait être expliquée par une deuxième éventualité, jusque là non abordée dans la littérature. En effet, les os de la 1ere inhumée auraient pu être contaminés par les « jus organiques » produits par la deuxième inhumée lors de sa décomposition. Cette hypothèse ne peut pas être exclue irrévocablement, néanmoins, la qualité des prélèvements (dents intactes et en place) ne permet pas d'envisager sérieusement cette possibilité. La logique privilégie donc l'hypothèse selon laquelle les deux individus seraient bien apparentés maternellement.

Les deux individus, une adolescente de sexe féminin ainsi qu'une femme âgée entre 20 et 30 ans, pourraient avoir eu des relations de plusieurs types, tel que mère-fille, soeurs, tante- nièce ou encore des relations bien plus éloignées (fig.12).

Figure 12 : Arbre généalogique montrant quels individus sont issus d'une même lignée mitochondriale. Les individus en rouge présentent le même haplogroupe mitochondriale que l'individu A.

Les méthodes archéothanalogiques pratiquées sur le chantier ont démontré que l'adolescente aurait été inhumée en 1er. Puis ces os auraient été réduits afin de fournir de l'espace à l'autre jeune femme. Malheureusement, il n'existe aucun argument taphonomique permettant d'obtenir un ordre de grandeur quant au temps séparant les deux inhumations. La décomposition du corps peut s'être faite aussi bien en quelques mois qu'en quelques années. Il n'est donc pas possible d'affiner nos hypothèses concernant le type de lien unissant ces deux femmes. Des analyses STR pourraient permettre de mettre en évidence des relations de type mère-fille ou soeurs, si cela est le cas.

La présence du périnatal dans ce sarcophage reste toujours un mystère, puisque malheureusement les analyses génétiques n'ont rien fournit pour cet individu.

À cette époque, les enfants n'étaient baptisés qu'à l'âge de 3 ou 4 ans, lorsqu'on était certain que l'enfant était en bonne santé et allait vivre, car un baptême coûtait fort cher. Les enfants décédés sans être baptisés étaient donc enterrés en tant que non-chrétiens, hors de l'enclos sacré. Il se pose alors toujours la question de la présence de ce périnatal au sein de cette nécropole et surtout au sein d'un sarcophage. L'hypothèse la plus plausible expliquant cette pratique est que ce bébé aurait été déposé aux coté de l'un de ses parents. Au vu des arguments archéothanatologiques énoncés dans la première partie du mémoire, ce périnatal aurait pu être l'enfant de la femme (2nde inhumée) située à ses cotés. Si tel était le cas ce sarcophage regrouperait donc trois personnes issues d'une même famille.

Cette étude a permis le rapprochement biologique de deux individus seulement mais certains résultats fragmentaires de ces analyses ne permettent pas d'écarter catégoriquement d'autres liens de parenté maternels entre d'autres individus, au sein des sarcophages et entre les sarcophages. Toutefois, au sein des tombes, nous pouvons d'ores et déjà exclure tous liens de parenté maternels entre les premier et troisième inhumés de la sépulture 169 ainsi qu'entre les premier et troisième inhumé de la sépulture 171 (fig.13). Nous pouvons donc aussi écarter tous lien de parenté entre ces quatre individus.

Figure 13 : Informations acquises en termes de relations de parenté maternelles.

X : aucun lien de parenté maternel ; ??? : Pas de liens maternels démontrés ; ? : liens maternels démontrés.

Ces analyses paléogénétiques très préliminaires permettent de mettre en évidence 2 cas de figures distincts :

Nous retrouvons des individus apparentés maternellement déposés dans le même sarcophage mais aussi des individus non apparentés maternellement déposés dans le même sarcophage. Cette information nous montre que l'on ne peut pas forcément globaliser les résultats. En effet, la mise en évidence de relations de parenté au sein d'un sarcophage ne veut pas dire que cela est forcément le cas pour le sarcophage voisin. Nous sommes donc peut être face à des gestes funéraires différents.

Ces dernières informations posent la question de l'apport des données paléogénétiques : sont-elles potentiellement généralisables à partir d'un site, d'un sarcophage, d'un groupe dans la nécropole ? La synthèse bibliographique présentée précédemment nous montre bien que dans la plupart des sites étudiés, il n'est pas possible de généraliser les phénomènes de regroupements familiaux car ceux-ci sont souvent propres à une seule sépulture ou à un secteur particulier.

VI Conclusion et perspectives

L'analyse génétique préliminaire de neuf individus issus de trois sarcophages du site de Jau-Dignac et Loirac a permis de mener à bien les objectifs principaux de cette étude qui était de tester la conservation de l'ADN et les contaminations.

Nous avons ainsi mis en évidence une bonne conservation générale de l'ADN chez ces individus. Dans l'ensemble, peu de contaminations ont été observées et les rares retrouvées ne semblent pas provenir des fouilleurs et manipulateurs du laboratoire. Nous pouvons donc affirmer que l'absence de port de gant lors de certains prélèvements n'a pas été reconnue comme geste contaminant dans le cadre de cette étude.

Concernant les résultats obtenus, nous avons trouvé de façon fiable la présence d'ADN authentique mais fragmentaire chez au moins cinq de ces individus (tabl. 9).

La bonne qualité des résultats nous laisse donc envisager la possibilité de poursuivre cette étude de lien de parenté par des analyses complémentaires. Dans cette éventualité, des répétitions (multiples extractions et amplifications) devront être tout d'abord réalisées sur le génome mitochondrial afin d'authentifier les résultats de la présente étude. Par la suite, des analyses portant sur l'ADN nucléaire (STR) pourront être considérés afin de pouvoir repérer d'éventuels liens de parenté paternels et de type parents-enfants.

Toutefois, il convient de signaler que l'analyse des relations de parenté entre vestiges humains anciens reste l'application de la paléogénétique la plus complexe et la plus problématique. En effet, l'obtention de marqueurs hautement informatifs pour les relations familiales (les STR autosomaux) ne reste qu'exceptionnelle sur des restes humains (Gill et al. 1994 ; Keyser-Tracqui et al. 2003 ; Deguilloux et al. 2009). Ceci est lié à une mauvaise conservation du génome nucléaire dans les vestiges anciens, ainsi qu'à la difficulté de leur analyse du fait de la dégradation de l'ADN (problème de « slippage » ou dérapage durant l'amplification de ces séquences répétées). En conséquence, les analyses paléogénétiques ne s'arrêtent souvent qu'à l'information partielle fournie par le génome mitochondrial (Capellini et al. 2004 ; Mooder et al. 2005 ; Rudbeck et al. 2005 ; Deguilloux et al. 2009).

A ce stade des analyses, nous pouvons toutefois apporter quelques informations en termes de relations de parenté maternelles. Les résultats obtenus montrent de façon fiable le partage d'une lignée maternelle par deux individus issus d'un même sarcophage. L'haplogroupe de ces individus (deux femmes) ne peut cependant pas être précisé car, compte tenu des données

dont nous disposons, il pourrait tout aussi bien s'agir de l'haplogroupe K que de l'haplogroupe H, tous deux présents en Europe du Nord et de l'Ouest. Le type de relation précis unissant ces deux femmes est une information inaccessible à ce stade de l'étude mais celle-ci pourrait peut-être être apportée par les STR, si la conservation de l'ADN s'y prête.

Compte tenu du caractère fragmentaire des résultats, certains liens de parenté maternels entre individus ne peuvent pas être exclus mais nous pouvons d'ores et déjà affirmer, qu'au sein de deux sarcophages sur trois, deux individus sur trois présentent des lignées maternelles différentes.

Pour terminer, il convient de souligner la difficulté de ce type d'étude de liens de parenté où se pose le problème non négligeable de la généralisation des résultats partiels. En effet, ce type d'étude se base souvent sur un nombre relativement restreint d'individus et il apparaît très imprudent de vouloir généraliser ces résultats à l'ensemble d'une nécropole, d'une période, d'une culture.

Annexe A : protocoles d'analyses d'ADN ancien

1- PREPARATION DES ECHANTILLONS

Ensacher dans un double sachet stérile les fragments d'échantillons ou échantillons. Bien laver la hotte à la javel entre chaque échantillon.

Mettre 15min les UV avant chaque manip/chaque échantillon

Manipuler avec gants, masque et blouse.

Emmener les sachets dans la salle ADNa, les nettoyer avec un papier imbibé de javel dans le sas et une nouvelle fois dans la salle extraction.

2- EXTRACTION PHENOL-CHLOROFORME

LA VEILLE

1- préparation de la salle = lavage paillasse à la javel, préparation des papiers alu + scalpels + spatules, exposition des échantillons aux UV et laisser la nuit au UV

2- préparation du tampon de base (volume final 50mL) :

9,3g EDTA O,5M (EDTA = chelateur d'ions, les cations libérés par le broyage vont se fixer sur l'edta et pas sur l'adn). de plus, L'EDTA en chelatant les ions Ca2+ va favoriser la disparition des complexes proteiques impliques dans les contacts cellule-cellule tels que jonctions serres et autres desmosomes. Les protéines impliques dans ces complexes sont dépendantes du Ca2+.

1,6g NaOH (pH=8), lyse les cellules par un détergent en milieu alcalin (SDSNaOH) afin de libérer l'ADN génomique et plasmidique. L'ADN génomique et les protéines sont précipitées par de l'acétate de sodium

qsp eau ultra-pure

3- préparation de la solution stock protéi nase K : 1mL dans 25mg de poudre.

Elle hydrolyse les protéines de toutes origines en quelques heures avec une préférence pour les liaisons peptidiques situées après les acides aminés hydrophobes (leucine, par exemple)

LE JOUR-J

1- allumer le four hybridation (55°C)

2- Préparer le tampon de lyse (10mL/échantillon) dans un tube Falcon 15mL

Tampon de base 1 0mL

N-Lauryl Sarcosyl 10% 500uL inactive les activités enzymatiques

Protéinase K (solution stock) 100uL

3- (laver et) broyer l'échantillon (papier alu + papier + papier alu dans sachet)

4- récupérer 0,5-1g de poudre dans un tube Falcon 15mL

5- fermer les tubes avec plusieurs épaisseurs de parafilm

6- incuber toute la nuit à 55°C, sous agitation (à l'abri des UV)

LE JOUR-J+1

Allumer la hotte chimique !!

1- centrifuger les tubes 10min à 800rpm

2- préparer xX3 tubes Falcon 50mL contenant 10mL de Phénol -Chlo-IAA chacun

3- transférer le surnageant dans les tubes Falcon contenant le phénol-chlo, fermer avec du parafilm et homogénéiser le tout doucement

4- centrifuger les tubes 10-15min à 1200rpm

5- répéter les étapes 2 à 4 deux fois

0- transférer environ 2mL du surnageant final sur les centricons (colonnes sur grands tubes fournis) et fermer à moitié avec du parafilm

7- centrifuger 2-5h à 3000rpm

8- jeter l'éluât, retourner la colonne sur les petits tubes fournis et ajouter 100uL d'eau sur la colonne

9- centrifuger 10min à 3000rpm

10- récupérer les éluats dans des eppendorfs

3- AMPLIFICATION

 

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

 

12 14 16 18 20 22 24 26

r

30 32 34 36 38

U

1,5 1,75 2 2,25 2,5 2,75 3 3,25 3,5 3,75 4 4,25 4,5 4,75

L

H2O d16NT9P2 149 165 182 12235 m30

Tampon 10 X 2,5 5 7,5 10 12,5 15 17,5 20 22,5 25 27,5 30 32,5 35 37,5 40 42,5 45 47,5 50

MgCl2 25 mM 2 4 6 8 10

BSA 20 mg/mL 1,25 2,5 3,75 5 6,25 7,5 8,75 10 11,3 12,5 13,8 15 16,3 17,5 18,8 20 21,3 22,5 23,8 25

dNTP 25 mM chaque 0,25 0,5 0,75 1 1,25

amorce Upper 0,5 1 1,5 2 2,5 3 3,5 4 4,5 5 5,5 6 6,5 7 7,5 8 8,5 9 9,5 10

amorce Louver 0,5 1 1,5 2 2,5 3 3,5 4 4,5 5 5,5 6 6,5 7 7,5 8 8,5 9 9,5 10

Taq 5 U/mL 0,5 1 1,5 2 2,5 3 3,5 4 4,5 5 5,5 6 6,5 7 7,5 8 8,5 9 9,5 10

4- VERIFICATION AMPLIFICATION

Faire migrer sur un gel d'agarose 2u L de bleu + 8u L de produit PCR

Prendre une photo

5- CLONAGE

Préparation des boîtes de culture

- diluer grossièrement le LB agar dans l'eau

- autoclaver la bouteille de mi lieu 15min à 121°C

- ajouter l'ampicilline lorsque le liquide est tiède (pas trop chaud)

- Couler dans les boîtes (assez épais)... du coup avec le mélange pour 20 boites, on en fait 12

épaisses

nombre de boîtes

eau (mL)

LB (g)

ampicilline (pi.)

1

25

0,8

12,5

2

50

1,6

25

3

75

2,4

37,5

4

100

3,2

50

5

125

4

62,5

6

150

4,8

75

7

175

5,6

87,5

8

200

6,4

100

9

225

7,2

112,5

10

250

8

125

11

275

8,8

137,5

12

300

9,6

150

13

325

10,4

162,5

14

350

11,2

175

15

375

12

187,5

16

400

12,8

200

17

425

13,6

212,5

18

450

14,4

225

19

475

15,2

237,5

20

500

16

250

- laisser refroidir sur la pà llasse et mettre au frigo (entourées de papier alu

La solution stock d'ampicilline doit être à 10mg/mL (20mL sur 200mg) et être conservée au

frigo.

Ligation - clonage

- Préparer la réaction de ligation (volume final 3uL): ingrédients conservés à -20°C 1 uL de produit PCR

0,5 uL de Salt solution

1 uL eau pure

0,5uL de TOPO vector

- Mélanger doucement et laisser incuber 5-30 min sur la paillasse

- Pendant l'incubation, préparer les bactéries :

. Préparer la glace

. Allumer le bain-marie à 42°C

. Décongeler dans la glace 1 tube de bactéries pour 2 réactions (aliquoter 30uL dans 2 eppendorfs et les placer dans la glace)

. Sortir le SOC du frigo (125 uL par réaction)

- Après incubation de la réaction de clonage, ajouter 1 uL de réaction de ligation à chaque tube de bactérie (conservation du rab' du produit de ligation au congélateur pour réemploi)

- Laisser les tubes de bactéries transformées dans la glace 5-30 min

- Plonger les tubes 30s au bain-marie à 42°C pour le choc thermique

- Transférer immédiatement dans la glace quelques minutes

- Hors glace, ajouter 125 uL de SOC

- Mettre sous agitation 1h, à 37°C, avec les boites

- Etaler 50uL de produit de transformation sur les boites, autour du bec bunzen (nettoyage paillasse alcool 70°c)

- incuber les boites retournées, à 37°c, toute la nuit (max. 18h puis à 4°C)

DECHETS !

- autoclaver les boites pétri dans les sacs biohazard

- stocker les cônes/eppendorfs dans une poubelle remplie de javel puis dans les sacs biohazard jusqu'à l'autoclave

5- VERIFICATION DES CLONES

- préparer une plaque avec 50uL d'eau ultra-pure dans chaque puit

- piquer un cône dans une colonie puis le laisser tremper dans les 50uL d'eau (dans plaque) = produit stock ADN clone. On récupère 24 clones par produit PCR

- Préparer le mix PCR sous la hotte

Pour 35uL final : 15uL MasterMix 2.5x

0.375uL M13FOR1 (10uM)

0.375uL M13REV1 (10uM)

14.25uL H2O

5uL ADN

- dispatcher le mix dans la plaque/ la barrette (30uL par puits) et ajouter 5uL de produit stock ADN clone.

- Fermer avec un autocollant alu la plaque PCR. Fermer avec un autocollant plastique la plaque des stocks ADN clone.

- lancer la PCR : programme M 13

- vérifier la taille des inserts sur gel d'agarose (5uL produit PCR + 2uL bleu)

- envoyer 30uL de produit PCR + additionnée de 10uL d'eau à Génome Express, dans des eppendorfs (IECB mardi matin 10h)

Bibliographie

ADACHI, N., UMETSU, K., TAKIGAWA, W. et SAKAUE, K. 2004 -- Phylogenetic analysis of the human ancient mitochondrial DNA. Journal of Archaeological Science, 31, p. 1339-1348.

BARRIEL,V. 1997 - L'ADN fossile [en ligne]. « http://www.cnrs.fr/cw/dossiers/dosevol/ decouv/articles/chap7/barriel .html ». 20 Avril 2009.

BOUWMAN, A. S., BROWN, K. A., PRAG, A. J. N. W. et BROWN, T. A. 2008 -- Kinship between burials from Grave Circle B at Mycenae revealed by ancient DNA typing. Journal of Archaeological Science, 35, p. 2580-2584.

CAPPELLINI, E., CHIARELLI, B., SINEO, L., CASOLI, A., GIOIA, A. D., VERNESI, C., BIELLA, M. C. et CARAMELLI, D. 2004 -- Biomolecular study of the human remains from tomb 5859 in the Etruscan necropolis of Monterozzi, Tarquinia (Viterbo, Italy). Journal of Archaeological Science, 31, p. 603-612.

CARTRON, I. et CASTEX, D. 2006 - Jau-Dignac et Loirac (Gironde) "La Chapelle Saint- Siméon". Rapport final d'opération (2001/2003-2005). Bordeaux : Service régional de L'archéologie d'Aquitaine, 373 p.

CASTEX, D. et CARTRON, I. 2006 - L'occupation d'un ancien îlot de l'estuairede la Gironde : du temple antique à la chapelle Saint-Siméon (Jau-Dignac-et-Loirac). Aquitania, XXII, p. 253-282.

CASTEX, D. et CARTRON, I. 2009 - Identité et mémoire d'un groupe aristocratique du haut
moyen âge : le site de «la chapelle» à jau-Dignac et Loirac (gironde). In ALDUC LE

BAGOUSSE A. (Edi,-IIÇKXmEFIRÇs-IdI-ISOEPTUe-IRX-ISOEPTHe-IIe-It'iÇKXPEFIRÇ ? Expressions du SRXYRII-IdEÇs-It'EX-delà. Actes de la table ronde de Caen (23-24 Mars 2007), Centre de recherches Archéologiques et Historiques Médiévales, sous presse.

CIPOLLARO, M., DI BERNARDO, G., GALANO, G., GALDERISI, U., GUARINO, F., ANGELINI, F. ET CASCINO, A. 1998 -- Ancient DNA in Human Bone Remains from Pompeii Archaeological Site. Biochemical and Biophysical Research Communications, 247, p. 901-904.

CLISSON, I., KEYSER-TRACQUI, C., FRANCFORT, H. P., CRUBEZY, E., SAMASHEV, Z. et LUDES, B. 2002 -- Genetic analysis of human remains from a double inhumation in a frozen kurgan in Kazakhstan (Berel site, Early 3rd Century BC). International Journal of Legal Medicine, 116, p. 304-308.

COOPER, A. et POINAR, H. N. 2000 -- Ancient DNA : Do It Right or Not at All. Science, 289, 1139 p.

DEGUILLOUX, M. F., MARCHET, A., BESSOU, M., PEMONGE, M. H., GUILLON, M. et WOSNY, L. 2009 - Analyse paléogénétique des sépultures du groupe D du site du Peyrat In Le site du Peyrat au Moyen Âge du Vè au XIVè siècle ap. J.-C. Aquitania. (Sous presse).

DUBUT, V., CHOLLET, L., MURAIL, P., CARTAULT, F., BÉRAUD-COLOMB, E., SERRE, M. et MOGENTALE-PROFIZI, N. 2004 - mtDNA polymorphisms in five French groups : importance of regional sampling. European Journal of Human Genetics, 12, p. 293- 300.

DUDAR, J.C., WAYE, J. S. et SAUNDERS, R. 2003 - Determination of a Kinship SystemUsing Ancient DNA, Mortuary Practice et Historic Records inan Upper Canadian Pioneer Cemetery. International Journal of Osteoarchaeology, 13, p. 232-246.

DUDAY H. 2005 - L'archéothanatologie ou archéologie de la mort. In : DUTOUR O.; HUBLIN J.J ET VETERMEERSCH B. (Eds.), Objets et méthodes en apléoanthropologie. Paris : Comité des travaux historiques et scientifiques, p. 153-207.

GILL, P., IVANOV P.L., KIMPTON, C., PIERCY, R., BENSON, N., TULLY, G., EVETT, E., HAGELBERG, E. et SULLIVAN, K. 1994 - Identification of the remains of the Romanov family by DNA analysis. Nature genetics, 6, p. 130-135.

GLEIZE, Y. 2006 - Gestion des corps, gestion de morts. Analyse archéo-anthropologique de réutilisations de tombes et de manipulations d'ossements en contexte funéraire au début du Moyen-Age (entre Loire et Garonne, V-VIIIème siècle). Université de Bordeaux 1 : Thèse de doctorat, 632 p.

HAAK, W., BRETT, G., JONG, H. N. D., MEYER, C., GANSLMEIER, R., HEYD, V., HAWKESWORTH, C., PIKEB, A. W. G., MELLER, H. et ALT, K. W. 2008 - Ancient DNA, Strontium isotopes, et osteological analyses shed light on social et kinship organization of the Later Stone Age. P.N.A.S, 105, p. 18226-18231.

KEYSER-TRACQUI, C., CRUBEZY, E. et LUDES, B. 2003 - Nuclear et Mitochondrial DNA Analysis of a 2,000-Year-Old Necropolis in the Egyin Gol Valley of Mongolia. American journal of human genetic, 73, p. 247-260.

LAFOREST, C. 2008 - Apport des variations non métriques dentaires : caractérisation et comparaison des populations du site " La chapelle" de Jau-dignac et Loirac (Gironde). Université de Bordeaux1 : Mémoire de Master 2, 72 p.

LOGAN, I. 2009 - mtDNA [en ligne]. « http://www.ianlogan.co.uk/mtdna.htm ». 20 Avril 2009.

MOODER, K., WEBER, A. W., BAMFORTH, F. J., LIEVERSE, A. R., SCHURR, T. G., BAZALIISKI, V. I. et SAVEL'EV, N. A. 2005 - Matrilineal affinities et prehistoric Siberian mortuary practices : a case study from Neolithic Lake Baikal. Journal of Archaeological Science, 32, p. 61 9-634.

POINAR, H. N. 2003 - The top 10 list: criteria of authenticity for DNA from ancient et forensic samples. In). International Congress Series 1239, p. 575-579.

PRUVOST, M., SCHWARZ, R., BESSA-CORREIA, V., CHAMPLOTA, S., GRANGEA, T. et GEIGL, E. M. 2008 - DNA diagenesis et palaeogenetic analysis: Critical assessment et methodological progress. Palaeogeography, Palaeoclimatology, Palaeoecology, 266, p. 211- 219.

RICHARDS, M., MACAULAY, V., HICKEY, E., VEGA, E., SYKES, B., GUIDA, V., RENGO, C., SELLITTO, D., CRUCIANI, F., KIVISILD, T., VILLEMS, R., THOMAS, M., RYCHKOV, S., RYCHKOV, O., RYCHKOV, Y., GÖLGE, M., DIMITROV, D., HILL, E., BRADLEY, D., ROMANO, V., CALÌ, F., VONA, G., DEMAINE, A., PAPIHA, S., TRIANTAPHYLLIDIS, C., STEFANESCU, G., HATINA, J., BELLEDI, M., RIENZO, A. D., NOVELLETTO, A., OPPENHEIM, A., NØRBY, S., SANTACHIARA-BENERECETTI, S., SCOZZARI, R., TORRONI, A. et BETELT, H.-J. 2000 - Tracing European founder lineages in the Near Eastern mtDNA pool. American Journal of Human Genetics, 67, p. 125 1- 1276.

ROUSSELET, F. et MANGIN, P. 1998 - Mitochondrial DNA polymorphisms: a study of 50 French Caucasian individuals et application to forensic casework. International Journal of Legal Medecine, 111, p. 292-298.

RUDBECK, L., THOMAS, M., GILBERT, P., WILLERSLEV, E., HANSEN, A. J., LYNNERUP, N., CHRISTENSEN, T. et DISSING, J. 2005 - mtDNA Analysis of Human Remains From an Early Danish Christian Cemetery. American Journal of Physical Anthropology, 128, p. 424-429.

SCHULTES, T., HUMMEL, C. et HERRMANN, B. 1999 - Amplification of Y-chromosomal STRs from ancient skeletal material. Human genetics, 104, p. 164-166.

SERK, P. 2004- Human mitochondrial DNA haplogroup J in europe et near East. Université de Tartu: thèse de doctorat, 65 p.

SMITH, D. G., MALHI, R. S., ESHLEMAN, J., LORENZ, J. G. et KAESTLE, F. A. 1999 - Distribution of mtDNA haplogroup X among Native North Americans. American Journal of Physical Anthropology, 110, p. 271-284.

TABERLET, P., GRIFFIN, S., GOOSSENS, B., QUESTIAU, S., MANCEAU, V. et ESCARAVAGE, N. 1996 - Reliable genotyping of samples with very low DNA quantities using PCR. Nucleic Acids Research, 24, p. 3189-3194.

THOMAS, M., GILBERT, P., BETELT, H. J., HOFREITER, M. et BARNES, I. 2005 - Assessing ancient DNA studies. Trends in Ecology & Evolution, 20, p. 541-544.

TREFFORT, C. 1996 - Du cimiterium christianorum au cimetière paroissial : évolution des espaces funéraires en Gaule du VIe au Xe siècle In FÉRACF (ed). Archéologie du cimetière Chrétien - Actes du 2ème Colloque A.R. C.H.E.A. Orléans, p. 55-63.

WILLIAMS, S. R., CHAGNON, N. A. et SPIELMAN, R. S. 2002 - Nuclear et Mitochondrial Genetic Variation in the Yanomamo·: A Test Case for Ancient DNA Studies of Prehistoric Populations. American Journal of Physical Anthropology, 117, p. 246-259.

YANG, D. Y. et WATT, K. 2005 - Contamination controls when preparing archaeological remains for ancient DNA analysis. Journal of Archaeological Science, 32, p. 33 1-336.

YANG, D. Y., ENG, B. et SAUNDERS, S. 2003 - Hypersensitive PCR, Ancient Human mtDNA et Contamination. Human Biology, 75, p. 355-364.

YANG, H., GOLENBERG, E. M. et SHOSHANI, J. 1997- A Blind Testing Design for Authenticating Ancient DNA Sequences. Molecular phylogenetics et evolution, 7, p. 261-265.