WOW !! MUCH LOVE ! SO WORLD PEACE !
Fond bitcoin pour l'amélioration du site: 1memzGeKS7CB3ECNkzSn2qHwxU6NZoJ8o
  Dogecoin (tips/pourboires): DCLoo9Dd4qECqpMLurdgGnaoqbftj16Nvp


Home | Publier un mémoire | Une page au hasard

 > 

Diversité génétique des Rhizobia associés à† un champ de pois d'Angole (Cajanus cajan l.) à† Yamoussoukro (centre de la Côte d'Ivoire)

( Télécharger le fichier original )
par Kouakou Romain FOSSOU
Ecole supérieure d'agronomie de l'institut national polytechnique Félix HouphouŽt Boigny de Yamoussoukro - Diplôme d'agronomie approfondie  2011
  

Disponible en mode multipage

Bitcoin is a swarm of cyber hornets serving the goddess of wisdom, feeding on the fire of truth, exponentially growing ever smarter, faster, and stronger behind a wall of encrypted energy

REPUBLIQUE DE COTE D'IVOIRE

Union - Discipline - Travail

Ministère de l'Enseignement Supérieur et de la Recherche Scientifique

Ecole Supérieure d'Agronomie (ESA)

en vue de l'obtention du Diplôme d'Agronomie Approfondie (DAA)

Option : Agronomie et Productions Végétales

Thème :

DIVERSITE GENETIQUE DES RHIZOBIA ASSOCIES A UN CHAMP DE POIS D'ANGOLE (Cajanus cajan L.)

A YAMOUSSOUKRO (CENTRE DE LA CÔTE D'IVOIRE)

Présenté par

FOSSOU Kouakou Romain

Elève Ingénieur Agronome (41e promotion, ENSA)

Jury de soutenance

Président : Prof. BROU Yao Casimir, Maître de Conférences à l'INP-HB/DFR ARA

Membres

Maître de stage/Encadreur Pédagogique : Prof. ZEZE Adolphe, Maître de Conférences à l'INP-HB/DFR ARA

Assesseurs : Dr AGNEROH ATCHAM Thérèse, Enseignant-chercheur à l'INP-HB/DFR ARA

M. KOUAKOU Kouadio Paul-Martial, Enseignant-chercheur à l'INP-HB/DFR ARA

M. NANDJUI Jacob, Enseignant-chercheur à l'INP-HB/DFR ARA

(c) Août 2011

RESUME

Le pois d'Angole (Cajanus cajan) est une importante légumineuse à graines dans les zones tropicales, notamment en Afrique de l'ouest. Toutefois, dans cette partie de l'Afrique, la diversité des rhizobia nodulant cette plante est pratiquement inconnue alors que son exploration peut permettre d'améliorer davantage ses intérêts, notamment en agriculture. La présente étude visait à évaluer la diversité génétique  des rhizobia nodulant un champ de pois d'Angole cultivé à Yamoussoukro (centre de la Côte d'Ivoire). Au total, 169 souches de rhizobia ont été isolées des nodules collectés. Le milieu synthétique TY utilisé pour cultiver et purifier les isolats avant l'étude génétique a permis de distinguer ceux-ci en deux groupes en fonction de leur vitesse de croissance. La diversité génétique a été étudiée à partir du polymorphisme de la longueur des fragments de restriction (RFLP) de leur ADNr 16S préalablement amplifié par une réaction de polymérisation en chaîne (PCR). L'analyse des produits de la digestion de l'ADNr 16S des isolats avec l'endonucléase Tsp 509I a révélé trois différents génotypes, dans les proportions allant de 11,2 % pour le moins représenté à 53,9 % pour le plus important. Ces résultats montrent qu'il y a une variabilité physiologique et génétique au sein des rhizobia nodulant le champ de pois d'Angole cultivé à Yamoussoukro.

Mots clés : Cajanus cajan ; Diversité ; Rhizobia ; Côte d'Ivoire ; ADNr 16S ; PCR-RFLP.

ABSTRACT

Pigeon pea (Cajanus cajan) is an important grain legume in tropical zone, notably in West Africa. However, in this area of Africa the diversity of rhizobia nodulating this plant is poorly understood even though its exploration can contribute to increase its interest, notably in agriculture. This work aimed at determining the genetic diversity of rhizobia nodulating a pigeon pea field in Yamoussoukro (Center Ivory Coast). One hundred sixty-nine (169) rhizobia's strains were isolated from field nodules. The use of TY medium allowed the purification and identification of two groups according to their growth rate. PCR-RFLP analyses of the 16S rRNA genes with the endonuclease Tsp 509I enabled the characterization of three main genotypes within the pigeon pea nodulating rhizobial community. The abundance of these genotypes are 11,2 % for the least to 53,9 % for the most important. These studies showed the evidence of physiological and genetic variability within the pigeon pea noduating rhozobial strains.

Keywords: Cajanus cajan; Diversity; Rhizobia; Côte d'Ivoire; rDNA16S; PCR-RFLP.

AVANT-PROPOS ET REMERCIEMENTS

Ce mémoire a été élaboré en vue de l'obtention du Diplôme d'Agronomie Approfondie (DAA). Il marque la fin d'études des étudiants agronomes de l'Ecole Supérieure d'Agronomie (ESA) de l'Institut National Polytechnique Félix Houphouët Boigny de Yamoussoukro (INP-HB). En effet, dans le souci de donner une formation complète à ses élèves ingénieurs, l'ESA a initié un stage de fin d'études d'une durée de six (6) mois portant sur un thème de recherche ou de développement.

C'est pour bénéficier de cette initiative pédagogique que nous avons séjourné successivement au Laboratoire d'Agronomie et Productions végétales de l'INP-HB et au Laboratoire Central de Biotechnologie (LCB) du Centre National de Recherche Agronomique (CNRA). Ce stage nous a permis de réfléchir sur le thème : «Diversité génétique des rhizobia associés à un champ de pois d'Angole (Cajanus cajan L.) à Yamoussoukro». Ce fut pour nous une occasion d'apprentissage d'une technique fondamentale dans l'identification moléculaire des micro-organismes (la Réaction de polymérisation en chaîne ou PCR) et aussi, un temps d'initiation à quelques rudiments de la recherche scientifique.

Ce stage a été proposé par Pr ZEZE Adolphe, enseignant-chercheur à l'INP-HB, à qui nous voulons traduire toute notre reconnaissance pour l'opportunité offerte. Pour nous, il a été plus qu'un encadreur pédagogique et de terrain durant ce stage. C'est pourquoi, nous voulons lui exprimer toute notre fierté de l'avoir côtoyé au moment où nous terminons notre parcours académique à l'INP-HB.

Au Dr AGNEROH née Thérèse ATCHAM, chef du Laboratoire de Phytopathologie et Biologie Végétale, nous exprimons toute notre reconnaissance pour avoir ouvert grandement les portes de son laboratoire pour nos nombreuses et diverses sollicitations durant ce stage.

Au Dr KOUASSI Nazaire, Directeur du LCB du CNRA, nous voulons exprimer notre gratitude pour l'accueil au sein de l'unité de biologie moléculaire et virologie de sa structure pour les manipulations moléculaires.

Nous remercions également MM. YAO Bognon, AMOAKON Adou, YOHOU Alain et Mlle DALE, personnel technique des deux laboratoires sus-cités, pour leur aide précieuse.

Enfin, à notre frère et unique collègue de fin d'études ZAKO, ainsi qu'à toute la 41ème promotion ENSA, nous disons merci.

TABLE DES MATIERES

RESUME I

ABSTRACT II

AVANT PROPOS ET REMERCIEMENTS III

LISTE DES TABLEAUX VII

LISTE DES FIGURES VIII

LISTE DES ANNEXES IX

SIGLES ET ABREVIATIONS X

DEDICACES XI

INTRODUCTION 1

PREMIERE PARTIE : REVUE BIBLIOGRAPHIQUE 3

CHAPITRE I : GENERALITES SUR LA SYMBIOSE LEGUMINEUSES-RHIZOBIA. 4

I.1. FIXATION BIOLOGIQUE DE L'AZOTE 4

I.2. SYMBIOSE LEGUMINEUSES/RHIZOBIA 5

I.2.1. Définition de la symbiose rhizobienne 5

I.2.2. Intérêts de la symbiose rhizobia-légumineuses 6

I.2.3. Caractérisation des deux partenaires 7

I.2.3.1. Rhizobia 7

I.2.3.2. Légumineuses 7

I.2.3.3. Caractéristiques du couple : infectivité, efficience et spécificité 8

CHAPITRE II : APERÇU SUR LE PROCESSUS DE NODULATION CONDUISANT A LA FIXATION AZOTEE 10

II.1. GENETIQUE DE LA NODULATION CHEZ LA BACTERIE 10

II.1.1. Gènes nod 10

II.1.1.1. Gènes nod D 10

II.1.1.2. Gènes nod communs (ABCIJ) 11

II.1.1.3. Gènes nod spécifiques (nod H, nod FE, nod G, nod MN, nod Q etc.) 11

II.1.1.4. Autres gènes nécessaires à la nodulation 12

II.1.2. Gènes nif 13

II.1.3. Gènes fix 14

II.2. GENETIQUE DE LA NODULATION CHEZ LA LEGUMINEUSE 14

II.3. SCHEMATISATION DES ETAPES DU PROCESSUS DE NODULATION 15

CHAPITRE III : TAXONOMIE DES RHIZOBIA 17

III.1. HISTOIRE DE LA TAXONOMIE RHIZOBIENNE 17

III.2. TAXONOMIE POLYPHASIQUE ET PHYLOGENIE DES RHIZOBIA 18

III.2.1. Taxonomie polyphasique 18

III.2.2. Notion de phylogénie chez les Rhizobia 18

III.3. CLASSIFICATION ACTUELLE DES RHIZOBIA 19

CHAPITRE IV : GENERALITES SUR LE POIS D'ANGOLE (Cajanus cajan L.) 21

IV.1. ORIGINE ET DISTRIBUTION GEOGRAPHIQUE DE LA PLANTE 21

IV.2. ZONES DE CULTURE ET IMPORTANCE DES PRODUCTIONS 21

IV.3. TAXONOMIE DU POIS D'ANGOLE 22

IV.3.1. Nomenclature 22

IV.3.2. Classification 22

IV.4. DESCRIPTION DU POIS D'ANGOLE 23

IV.4.1. Description botanique 23

IV.4.2. Ecologie 24

IV.4.3. Mode de multiplication et systèmes de culture 24

IV.4.4. Croissance, développement et rendement 24

IV.4.5. Ennemis et maladies de Cajanus cajan 25

IV.5. IMPORTANCE DE LA CULTURE DU POIS CAJAN 25

IV.5.1. Importance nutritionnelle du pois cajan 26

IV.5.2. Importance agronomique du pois cajan 26

IV.5.3. Importance du pois cajan en Afrique 27

CHAPITRE V : RHIZOBIA SYMBIOTIQUES DU POIS CAJAN 28

DEUXIEME PARTIE : ETUDE EXPERIMENTALE 29

CHAPITRE VI : PRESENTATION DE L'ETUDE ET DES LABORATOIRES D'ACCUEIL 30

VI.1. OBJECTIFS DE L'ETUDE 30

VI.2. PRESENTATION DU SITE DE COLLECTE DES ECHANTILLONS 30

VI.3. PRESENTATION DES LABORATOIRES D'ACCUEIL DE L'ETUDE 30

CHAPITRE VII : MATERIEL ET METHODES 31

VII.1. MATERIEL 31

VII.1.1. Matériel vivant 31

VII.1.2. Matériel technique 31

VII.2. METHODES 33

VII.2.1. Récolte des nodules et isolement des souches bactériennes 33

VII.2.2. Préparation des cellules bactériennes par effet thermique 34

VII.2.3. Amplification et digestion de la région 16S de l'ADNr des rhizobia par

PCR-RFLP 34

VII.2.3.1. Principe de la PCR-RFLP et choix du gène de l'ADNr 16S 34

VII.2.3.1.1. Principe de la PCR-RFLP 34

VII.2.3.1.2. Choix du gène de l'ADNr 16S 35

VII.2.3.2 Réalisation de la PCR-RFLP 36

VII.2.3.2.1. Principe de la PCR 36

VII.2.3.2.2. Choix des amorces et milieu réactionnel de la PCR 37

VII.2.3.2.3. Programme de la PCR 38

VII.2.3.2.4. Electrophorèse sur gel d'agarose et visualisation des gels 39

VII.2.3.2.5. Migration de l'ADN et visualisation 39

VII.2.3.2.6. Digestion des amplifiats 40

CHAPITRE VIII : RESULTATS ET DISCUSSION 41

VIII.1. RESULTATS 41

VIII.1.1. Croissance des bactéries sur milieu TY solide 41

VIII.1.2. Amplification par PCR de l'ADNr 16S 41

VIII.1.3. Produits de digestion 42

VIII.2. DISCUSSION DES RESULTATS 44

CONCLUSION ET PERSPECTIVES 46

REFERENCES BIBLIOGRAPHIQUES 47

ANNEXES 57

LISTE DES TABLEAUX

Tableau I : Exemples des différents types de micro-organismes fixateurs d'azote 4

Tableau II : Classification des rhizobia 20

Tableau III : Noms communs du pois d'Angole en quatre langues principales 22

Tableau IV : Amorces choisies pour l'amplification des fragments d'ADNr 16S 37

Tableau V : Composition du milieu réactionnel unitaire commun de la PCR 38

Tableau VI : Caractéristiques de l'enzyme de restriction Tsp 509 I 40

Tableau VII : Composition du milieu réactionnel unitaire commun de la digestion 40

LISTE DES FIGURES

Figure 1 : Nodules racinaires (a) et tige portant des nodules aériens matures (b) 5

Figure 2 : Symbiose fixatrice d'azote Rhizobia-Parasponia sp. 6

Figure 3 : Diversité des Légumineuses 8

Figure 4: Différents types de gènes nod 11

Figure 5 : Nitrogénase et mécanismes d'action 13

Figure 6 : Etapes du processus de nodulation lors de la symbiose Légumineuse-rhizobia 16

Figure 7 a : Inflorescences de Cajanus cajan 23

Figure 7 b : Fruit sec en déhiscence 23

Figure 8 : Feuillage rejeté par une culture de pois cajan en jachère améliorée 27

Figure 9 a : Nodosités sur racines de C. cajan 31

Figure 9 b : Nodosités étalées pour l'isolement 31

Figure 10 : Présentation d'un thermocycleur 32

Figure 11: Appareil de migration 32

Figure 12 : Transilluminateur relié à un ordinateur 32

Figure 13 : Organisation de l'opéron de l'ADNr observé chez les procaryotes 35

Figure 14 : Etapes de la PCR pour un cycle d'amplification 37

Figure 15 : Mode de croissance sur milieu TY en 24 heures et 48 heures des groupes de rhizobia isolés du pois cajan 41

Figure 16 : Résultats d`amplification de l'ADNr 16S des rhizobia isolés de Cajanus cajan 42

Figure 17 : Différents profils de digestion obtenus avec l'enzyme de restriction Tsp 509I 42

Figure 18 : Proportions relatives des trois profils obtenus par PCR-RFLP 43

Figure 19 : Proportions des profils de digestion des souches supposées à croissance lente 43

LISTE DES ANNEXES

ANNEXE I : Classification des rhizobia selon les séquences du gène de l'ARN 16 S 58

ANNEXE II : Présentation des structures et des laboratoires d'accueil de l'étude 60

ANNEXE III : Composition du milieu TY (Tryptone Yeast Agar) en g/l 63

SIGLES ET ABREVIATIONS

ADNr : Acide DésoxyriboNucléique ribosomique

ARNr : Acide RiboNucléique ribosomique

ATP : Adénosine Tri-Phosphate

BET: Bromure d'Ethydium

CNRA : Centre National de Recherche Agronomique

DAA : Diplôme d'Agronomie Approfondie

dct : dicarboxylate transport genes

DFR-ARA : Département de Formation et de Recherche Agriculture et Ressources Animales

dNTP : désoxyriboNucléotide TriPhosphate

ENSA : Ecole Nationale Supérieure Agronomique

ESA : Ecole Supérieure d'Agronomie

FAO: Food and Agriculture Organization

GS : Glutamine Synthétase

hsn : host specific nodulation 

INP-HB : Institut National Polytechnique Félix Houphouët Boigny

ITS: Intergenic Transcribed Spacer

LCB : Laboratoire Central de Biotechnologie

MoFe : Molybdène Fer

pb : paire de base

PCR : Polymerase Chain Reaction

RFLP : Restriction Fragment Lenght Polymorphism

SDS-PAGE: Sodium Dodecyl Sulfate- Polyacrilamide Gel Electrophoresis

Taq : Thermus aquaticus

TBE: Tris Borate EDTA

TY: Tryptone Yeast extract

USDA: United State Department of Agriculture

UV: Ultra Violet

YMA: Yeast Manitol Agar

DEDICACES

Ce Mémoire, conclusion de toute notre formation à l'INP-HB est dédié à nos parents :

À notre père FOSSOU Félix et à notre mère POKOU Florentine pour la vie qu'ils nous ont donnée;

À notre cousin KONAN Georges et sa famille pour le soutien moral et financier indéfectible ;

Et enfin,

À la famille ETTIEN pour sa grande contribution à la réalisation de notre cursus scolaire à Yamoussoukro.

FOSSOU KOUAKOU ROMAIN

INTRODUCTION

 

L'azote, en tant que composant omniprésent dans les biomolécules (protéines, acides nucléiques, vitamines...), est l'élément constitutif des végétaux le plus important après le carbone. Malheureusement, la concentration de ses formes assimilables dans le sol (ammonium, nitrate, etc.) est souvent limitante pour la bonne croissance des plantes et constitue de ce fait, très fréquemment, le facteur clé de la production agricole (ROGER et al., 1996).

Certaines plantes, notamment les légumineuses, ont réussi à s'affranchir de cette limitation en établissant des relations symbiotiques avec des bactéries capables de fixer l'azote atmosphérique grâce à un complexe enzymatique, la nitrogénase. Cette symbiose est indubitablement le facteur majeur expliquant le grand succès de cette famille de plantes en agriculture (NOEL, 2009). En effet, cultivées pour leurs graines (riches en protéines) ou pour leurs propriétés fourragères, les légumineuses occupent 12 à 15% des terres cultivables dans le monde et représentent 27% de la production mondiale des cultures. Plus de 35% des huiles végétales proviennent de leurs productions avec en tête le soja et l'arachide et les légumineuses à graines contribuent à elles seules pour 33% aux besoins azotés de l'alimentation humaine (VANCE et al., 2000 ; GRAHAM et VANCE, 2003). Par ailleurs, la rotation des cultures avec ces plantes permet d'économiser les engrais azotés, très coûteux en énergie fossile et contribuant à l'effet de serre via l'émission de grandes quantités d'oxyde nitrique (CRUTZEN et al., 2007).

L'étude de cette importante symbiose depuis plus de 100 ans a permis de comprendre certains mécanismes de son établissement et d'explorer la diversité biologique des deux types de partenaires associés. Dans certains cas, ces études ont conduit à la sélection de souches très performantes de bactéries fixatrices d'azote et le développement de leur inoculum. Les inoculats permettent en effet d'améliorer la productivité des légumineuses en culture, de mieux réduire leur dépendance vis-à-vis des engrais azotés et de s'inscrire par conséquent dans la logique d'un développement agricole durable.

Pour la légumineuse tropicale Cajanus cajan ou pois d'Angole (5ème légumineuse à graines en terme de production), l'étude de la diversité de ses symbiotes a permis d'identifier aujourd'hui environ une dizaine d'espèces bactériennes. Celles-ci appartiennent à trois principaux genres de rhizobia ou Bactéries Nodulatrices de Légumineuses (BNL). Il s'agit des genres Rhizobium (BENDER et al., 1986; WOLDE-MESKEL et al., 2004 a), Sinorhizobium (CHEN et al., 1988 ; DUBEY et al., 2010) et Bradyrhizobium (RAMSUBHAG et al., 2002 ; WOLDE-MESKEL et al., 2004 a). Toutefois, ces études taxonomiques ont été principalement menées en Inde et en Afrique de l'Est, respectivement premier et deuxième centre de diversité et de culture de cette légumineuse à graines (SMARTT, 1990 ; VAN DER MAESEN, 1990 ; SINGH, 1991 ; SONGOK et al., 2010).

En Afrique occidentale, quelques études similaires ont été menées seulement au Nigéria (ABAIDOO et al., 2000), alors que toute cette partie du continent africain constitue également une zone de production d'importance de cette plante de grande utilité (NENE et SHEILA, 1990).

Notre stage se propose d'étudier la diversité génétique des rhizobia nodulant le pois d'Angole en culture dans un champ à Yamoussoukro. Il s'agit d'évaluer par PCR-RFLP de l'ADNr 16S, la variabilité génétique des rhizobia isolés de ce champ. Une collection locale des partenaires symbiotiques de cette légumineuse sera également constituée.

Ce document qui présente les résultats de cette étude, s'articule autour de deux parties. La première fait une synthèse bibliographique sur le pois d'Angole, les rhizobia et le processus de nodulation. Quant à la seconde, elle concerne l'étude expérimentale qui décrit le site de collecte des échantillons et les manipulations au laboratoire, le matériel et les méthodes utilisés et enfin, présente les résultats qui feront l'objet d'une discussion.

PREMIERE PARTIE :

REVUE BIBLIOGRAPHIQUE

 
 

CHAPITRE I : GENERALITES SUR LA SYMBIOSE LEGUMINEUSES-RHIZOBIA

I.1- FIXATION BIOLOGIQUE DE L'AZOTE (FBA)

L'azote moléculaire (N2), constituant majeur de l'atmosphère mais chimiquement inerte, ne peut être utilisé que par certains micro-organismes procaryotes appelés fixateurs biologiques de N2. Ils sont soit libres, soit symbiotiques, c'est à dire associés à d'autres organismes. La découverte de cette propriété fixatrice de N2 atmosphérique par les micro-organismes remonte à la fin du XIXè siècle avec les travaux de plusieurs scientifiques dont HELLRIEGEL et WILFART (1888)1(*) et BEYERINCK (1888)2(*). Depuis, de nombreux genres et espèces bactériennes ont été reconnus comme fixateurs de N2 atmosphérique. Ces organismes présentent pratiquement tous les types de comportements en ce qui concerne les relations plante-micro-organisme, les relations avec l'oxygène et les modes trophiques comme le montre le tableau I:

Tableau I : Exemples des différents types de micro-organismes fixateurs d'azote (D'après ROGER et al., 1996) 

Micro-organismes libres

· Aérobies


· Hétérotrophes Azotobacter spp.; Klebsiella pneumoniae;

Beijerinckia indica; Azospirillum lipoferum


· Phototrophes: Cyanobactéries


· Hétérocystées Nostoc; Anabaena; Calothrix; Tolypothrix


· Homocystées Trichodesmium; Oscillatoria


· Unicellulaires Gloeothece; Gloeocapsa

· Anaérobies


· Hétérotrophes Clostridium pasteurianum; Desulfovibrio vulgaris;

Desulfotomaculum spp. ; Methanobacterium spp.


· Phototrophes Rhodospirillum rubrum; Rhodobacter capsulata;

Chromatium vinosum

Microorganismes symbiotiques

· Légumineuses


· à nodules racinaires Sinorhizobium meliloti; Rhizobium leguminosarum

Bradyrhizobium japonicum; S. fredii etc.


· à nodules caulinaires Azorhizobium caulinodans

· Symbioses actinorhiziennes Frankia

· Symbioses à cyanobactéries


· Azolla Anabaena azollae


· Cycas Anabaena cycadeae


· Lichens Nostoc


· Mousses et hépatiques Nostoc

De tous ces systèmes fixateurs de N2 atmosphérique, les associations symbiotiques sont les plus importantes. Celles-ci sont responsables chaque année de la réduction de 120 millions de tonnes (Mt) d'azote atmosphérique en ammonium (FREIBERG et al., 1997), pour un niveau total de réduction estimé à 175 Mt/an (ROGER, 1996). Parmi ces associations symbiotiques, celle existant entre les plantes de la famille des Légumineuses et les Rhizobia est l'une des plus efficaces. En effet, les légumineuses cultivées en association avec leurs symbiotes fixent 40 à 60 Mt d'azote par an, tandis que 3 à 5 Mt d'azote sont fixées par les légumineuses des écosystèmes naturels (GRAHAM et VANCE, 2003). Par ailleurs, cette symbiose est aussi responsable de la plus grande partie de la fixation d'azote dans les sols agricoles et fait l'objet d'étude depuis un siècle (NUTMAN, 1981). Les paragraphes suivants se consacreront à une synthèse des connaissances importantes actuellement acquises sur elle.

I.2- SYMBIOSE LEGUMINEUSES/RHIZOBIA

I.2.1- Définition de la symbiose rhizobienne

La symbiose rhizobienne est une association entre les plantes de la famille des légumineuses et des bactéries du type Rhizobium permettant de réduire l'azote atmosphérique en des formes assimilables par les plantes. A bénéfice réciproque, cette association donne lieu à des interactions multiples entre les deux partenaires. Au cours de ces interactions, un nouvel organe, le nodule, est formé sur les racines (Figure 1a) ou plus rarement sur les tiges à partir de primordia racinaires dormants et disposés en rang le long de la tige (Figure 1b). C'est au sein de cet organe protecteur que l'azote atmosphérique est fixé par les bactéries.

(a) (b)

Figure 1 : Nodules racinaires (a) et tige portant des nodules aériens matures (b)

(DUHOUX et NICOLE, 2004)

A ce jour, les seules plantes non légumineuses capables de noduler avec des rhizobia (Sinorhizobium et Bradyrhizobium spp.) sont de petits arbres tropicaux appartenant au genre Parasponia, de la famille des Ulmacées (LAFAY et al., 2006 ; NOEL, 2009) (Figure 2).

C

A

B

Figure 2 : Symbiose fixatrice d'azote Rhizobia-Parasponia sp.

A. Tige de Parasponia. B. Nodule multilobé de Parasponia rigida. C. Coupe longitudinale d'un lobe nodulaire de Parasponia (D'après LANCELLE et TORREY, 1985)

Bien que la symbiose légumineuse-Rhizobium soit une interaction hautement adaptée et régulée, il ne s'agit pas d'une interaction obligatoire ou permanente. En effet, les deux partenaires peuvent vivre indépendamment et de manière autonome, et chaque nouvelle génération de plante doit être infectée par de nouvelles bactéries (KNEIP et al., 2007). Lorsque cette symbiose a lieu, elles présentent de nombreux intérêts aussi bien pour les deux partenaires que pour la pratique agricole.

I.2.2- Intérêts de la symbiose rhizobia-légumineuses

Cette symbiose présente de nombreux avantages pour les légumineuses. En effet, celle-ci leur permet d'avoir une bonne croissance sur des sols carencés en azote. A titre d'exemple, le pois d'Angole (Cajanus cajan) qui est cultivé sous les tropiques incluant les régions semi-arides peut satisfaire jusqu'à 96% de ses besoins azotés par le biais de celle-ci (KUMAR RAO et al., 1986). De ce fait, cette symbiose est indubitablement le facteur majeur à l'origine du grand succès de la famille des Légumineuses parmi les végétaux (NOEL, 2009).

A l'opposé, la plante subvient aux besoins énergétiques de la bactérie au cours de cette symbiose en fournissant des substances carbonées résultant de la photosynthèse. Elle lui offre également un microenvironnement très particulier et nécessaire à la fixation de l'azote. Par ailleurs, outre l'augmentation au niveau du sol de la population des rhizobia spécifiques à la légumineuse hôte après culture, la symbiose fournirait un cadre de reproduction bénéfique qui favoriserait l'évolution des espèces bactériennes (NOEL, 2009).

I.2.3- Caractérisation des deux partenaires

I.2.3.1- Rhizobia

Les rhizobia sont des fixateurs symbiotiques de l'azote atmosphérique dans les nodules des racines ou des tiges des plantes légumineuses où ils se différencient en bactéroïdes (GRAHAM, 1991 ; HAUKKA et al., 1998 ; GAGE, 2004). Ces bactéries du sol sont de formes bâtonnets, à Gram négatif (paroi hétérogène, coloration rouge). Elles sont non sporulant, d'une largeur variant entre 0,5 et 0,9 ìm et une longueur comprise entre 1,2 et 3 ìm. Elles sont mobiles par un seul flagelle polaire (cas de Mesorhizobium) ou par deux à six flagelles péritriches (JORDAN, 1984 ; SOMASEGARAN et HOBEN ,1994).

Au niveau de leur matière sèche, les cellules des rhizobia contiennent 52 à 55 % de carbone et 4 à 5 % d'azote (ALLEN et ALLEN, 1950).

Les milieux au mannitol et aux extraits de levure sont les plus utilisés pour la culture de ces bactéries (ALLEN et ALLEN, 1950). Une croissance optimale de la plupart des souches de Rhizobium a lieu à des températures variant de 25 à 30°C et un pH compris entre 6,0 et 7,0 (SOMASEGARAN et HOBEN ,1994).

I.2.3.2- Légumineuses

Les Légumineuses représentent une famille importante et variée des Angiospermes. En effet, il s'agit de la troisième plus grande famille chez les plantes supérieures avec plus de 720 genres et 20 000 espèces allant des espèces herbacées comme la luzerne, aux arbres composant les forêts tropicales d'Amérique Latine et d'Afrique (CRONK et al., 2006), à l'image des acacias. Leurs fruits (gousses) les caractérisent par rapport aux autres végétaux. Classiquement, les Légumineuses sont divisées en trois sous-familles à savoir les Caesalpinoideae, les Mimosoideae et les Papilionoideae (Faboideae). La plupart des espèces cultivées appartiennent à la dernière sous-famille citée.

Les Papilionoideae représentent la sous-famille la plus diverse avec 429 genres et environ 12000 espèces (YOUNG et al., 2003). Deux groupes majeurs de plantes cultivées sont présents au sein de cette sous-famille. Il s'agit des légumineuses tempérées encore appelées Galégoides, avec les genres Cicer (pois chiche), Lens (lentilles), Lotus (lotier), Medicago (luzerne), Melilotus (mélilots), Pisum (pois), Trifolium (trèfle) et Vicia (vesce) etc. Le deuxième groupe est celui des légumineuses tropicales ou Phaséolides, avec notamment les genres Phaseolus (haricot), Glycine (soja), Vigna (vigne) et Cajanus (pois d'Angole).

Les Caesalpinoideae (150 genres et 2 200 espèces) sont principalement constituées de plantes ornementales et d'arbres à bois ou alimentaires (Tamarindus etc.) (YOUNG et al., 2003). Quant aux plantes de la sous-famille des Mimosoideae (62 genres et environ 2 500 espèces), elles sont présentes principalement dans les forêts tropicales et subtropicales, avec notamment les genres Acacia et Albizia (YOUNG et al., 2003).

La figure 3 ci-après illustre de façon non exhaustive, la grande diversité biologique au sein de la famille des Légumineuses.

Figure 3 : Diversité des Légumineuses

A. Glycine max, le soja (Papilionoideae);

B. Vigna unguiculata, le niébé (Papilionoideae) ;

C. Pisum sativum, le pois cultivé (Papilionoideae) ;

D. Cercis siliquastrum (Caesalpinoideae) ;

E. Albizia julibrissin (Mimosoideae);

F. Acacia albida (Mimosoideae).

(D'après VERNIE, 2008)

I.2.3.3- Caractéristiques du couple : infectivité, efficience et spécificité

La capacité des bactéries d'infecter les racines de légumineuses et de former des nodules s'appelle "'infectivité", alors que le terme "efficience" donne une indication de la capacité des plantes nodulées à fixer l'azote (BECK et al., 1993). Selon les mêmes auteurs,

l'infectivité est le résultat de l'interaction de la légumineuse hôte et la souche envahissante.

Toutes les légumineuses ne sont pas capables de noduler et l'effectivité de la nodulation concerne 88 % des espèces examinées (GRAHAM et VANCE, 2003). Par ailleurs, les espèces déjà étudiées pour leur aptitude à la nodulation représentent 20 % de l'effectif total des légumineuses connues (NOEL, 2009). Des trois sous-familles, les Caesalpinoideae sont les moins nodulantes. Seulement 30 % d'entre elles forment des nodules, contre 90 % chez les deux autres sous-familles (SOLTIS et al., 1995). Ces proportions seraient de 10 ; 80 et 90 % respectivement pour les Caesalpinoideae, les Mimosoideae et les Papilionoideae selon NOEL (2009).

La spécificité peut être définie par la diversité taxonomique des partenaires auxquels l'autre symbiote peut s'associer. La spécificité peut être stricte (une seule espèce de bactérie pour un seul genre de légumineuse) ou large, c'est-à-dire concerner plusieurs taxons bactériens ou de légumineuses (PRIN et al., 1993). En général, chaque légumineuse ne peut être infectée que par un nombre restreint de souches de rhizobia. Par exemple, la légumineuse Medicago truncatula ne peut être nodulée que par Sinorhizobium meliloti et S. medicae (VERNIE, 2008). Concernant les rhizobia, si certains ont une spécificité très restreinte, d'autres par contre ont une très large spécificité d'hôtes. Ainsi, la souche Sinorhizobium (Ensifer) sp. NGR 234 peut noduler 353 espèces de légumineuses appartenant à 112 genres différents et représentant les trois sous-familles des Légumineuses. Elle peut même noduler l'Ulmacée Parasponia andersonii (PUEPPKE et BROUGHTON, 1999 ; NOEL, 2009).

CONCLUSION PARTIELLE

Les légumineuses réalisent avec les bactéries du sol de type rhizobia une symbiose à bénéfice réciproque (mutualisme). En général très spécifique, cette symbiose est à l'origine du grand succès de la famille des Légumineuses au niveau de l'agriculture où elles occupent, en termes d'importance, la seconde place derrière les Graminées. Le chapitre suivant présentera son mode d'établissement.

CHAPITRE II : APERÇU SUR LE PROCESSUS DE NODULATION CONDUISANT A LA FIXATION AZOTEE

 

Le processus d'une symbiose fixatrice d'azote débute par la formation de nodosités au niveau des racines ou des tiges de la plante hôte. La formation de ces nodosités survient quand les rhizobia pénètrent leur hôte d'une manière coordonnée et contrôlée. De nombreux gènes appartenant aussi bien aux bactéries qu'à la plante hôte interviennent au cours de ce processus.

II.1- GENETIQUE DE LA NODULATION CHEZ LA BACTERIE

En général, trois types de gènes symbiotiques interviennent dans le processus de nodulation et de fixation azotée chez la bactérie. Il s'agit des gènes nod nécessaires à la nodulation, des gènes nif codant pour la nitrogénase et des gènes fix indispensables pour la fixation de l'azote. Chez la plupart des rhizobia (Rhizobium, Allorhizobium et Sinorhizobium etc.), ces gènes symbiotiques sont situés sur un grand plasmide symbiotique appelé pSym (MERCADO-BLANCO et TORO, 1996 ; NOEL, 2009). Chez les genres Bradyrhizobium, Azorhizobium et chez l'espèce Mesorhizobium loti, ces gènes symbiotiques, qu'on élucidera dans les paragraphes suivants, sont situés sur le chromosome (SHARMA et al., 1993).

II.1.1- Gènes nod

Les gènes de nodulation ou gènes nod incluent des gènes communs et des gènes spécifiques de l'hôte à infecter (gènes hsn) (BROUGHTON et al., 2000 ; SPAINK, 2000). En 2000, au total 13 gènes de nodulation étaient déjà connus. Il s'agit des opérons nod ABCIJ, nod FEL, nod MNT, du nod O et du nod D (PERRET et al., 2000).

II.1.1.1- Gène nod D

Le gène nod D négocie les premières étapes de la nodulation chez la bactérie. Il est par conséquent le premier gène nod transcrit lors du processus de nodulation. Sa transcription se fait de manière constitutive (GEURTS et BISSELING, 2002) et l'activation de son produit, le Nod D, est réalisée par les flavonoïdes qui sont des molécules émises par les racines des légumineuses. Une fois activé, le Nod D se lie aux sites régulateurs des opérons porteurs des autres gènes nod et active leur transcription. La Figure 4 ci-après illustre ce rôle régulateur du Nod D et présente les autres gènes de nodulation.

Figure 4 : Différents types de gènes nod (ANONYME, 2010)

II.1.1.2- Gènes nod communs (ABCIJ)

Les gènes nod communs (nod A, B, C, I et J) sont des gènes de nodulation communs à tous les rhizobia jusqu'ici étudiés. Ils sont situés sur un opéron duquel les nod ABC sont essentiels pour la nodulation. Ces derniers sont physiquement et fonctionnellement conservés chez toutes les espèces de rhizobia et leurs mutations provoquent une perte complète de la capacité à infecter et à noduler les plantes hôtes. En effet, ces gènes sont indispensables pour induire la déformation des poils absorbants en forme de crosse (curling) et inciter les cellules végétales à se diviser (BREWIN et al., 1992 ; PELMONT, 1995).

II.1.1.3- Gènes nod spécifiques (nod H, nod FE, nod G, nod MN, nod Q etc.)

Les gènes hsn (host specific nodulation) sont des gènes spécifiques de la plante à infecter (PELMONT, 1995). Ils ne sont pas nécessairement présents ou fonctionnellement conservés chez tous les rhizobia (SHARMA et al., 1993). Ces gènes sont responsables de la spécificité d'hôte et de la reconnaissance entre la bactérie et la plante, étape préalable à l'infection (DAVET, 1996). Leur mutation provoque un retard, une réduction de la nodulation ou une modification de leur spécificité d'hôte (DEBELLE et SHARMA, 1986 ; DEBELLE et al., 1986; HORVATH et al., 1986 ; CERVANTES et al., 1989).

Après leur transcription, les gènes nod produisent des enzymes qui contrôlent la synthèse de molécules indispensables au processus de nodulation. Ces signaux, qui sont généralement connus sous le nom de facteurs Nod, sont des molécules lipo-chito-oligosaccharidiques (LCOs) (TEREFEWORK, 2002). La synthèse du noyau lipooligosaccharide de ces molécules est contrôlée par les gènes nod ABCD tandis que les gènes hsn assurent les diverses substitutions de celles-ci (DEBELLE et al., 2001).

Les facteurs Nod sont responsables de la spécificité de la reconnaissance entre les symbiotes et du déclenchement de l'organogenèse nodulaire. En effet, même émis à des concentrations minimales, ces signaux peuvent déclencher des réponses symbiotiques chez la plante telles que la déformation des poils radiculaires, la division corticale des cellules et la formation de nodule primordial (DEBELLE et al., 2001). L'identification du signal Nod est une étape essentielle dans l'établissement du dialogue moléculaire à l'origine de la symbiose entre les légumineuses et les bactéries fixatrices d'azote.

II.1.1.4 - Autres gènes nécessaires à la nodulation

En plus des gènes nod, les rhizobia possèdent d'autres gènes essentiels au processus de nodulation. Il s'agit des gènes exo, lps et ndv qui codent pour l'expression et la synthèse des molécules de structure de la surface bactérienne (BROUGHTON et al., 2000 ; SPAINK, 2000). Ces molécules qui sont successivement les exopolysaccharides (EPS), les lipopolysaccharides (LPS) et les â-glucans sont nécessaires pour le développement continu du fil d'infection. Elles sont par ailleurs considérées comme d'importants facteurs dans l'efficacité symbiotique (BREEDVELD et MILLER, 1998). En effet, les â-glucans sont majoritairement des molécules du périplasme qui permettent la croissance des bactéries sous des conditions hypoosmotiques (PFEFFER et al., 1994). Ils jouent également un rôle important dans la suppression du déclenchement du mécanisme de défense par les phytoalexines chez l'hôte (BHAGWAT et al., 1996). Quant aux exopolysaccharides, ils fonctionnent comme des messagers pendant l'infection (GONZALEZ et al., 1996). Enfin, les mutants de rhizobia défectifs en la synthèse ou à faible production de lipopolysaccharides n'ont pas la capacité d'induire la formation de cordons d'infection. Ils perdent également leur capacité compétitive ou forment des nodosités incomplètement développées (LAGARES et al., 1992).

Faisant suite à l'activité des gènes d'infection et de nodulation, deux groupes de gènes interviennent dans les étapes tardives de la symbiose. Il s'agit des gènes nif et fix.

II.1.2- Gènes nif

Les gènes nif existent chez plusieurs bactéries dont les rhizobia (YOUNG et HAUKKA, 1996). Chez ces derniers, ces gènes codent pour la synthèse d'un complexe enzymatique catalysant la réduction de l'azote et connu sous le nom de nitrogénase ou dinitrogénase (HOPKINS, 2003). Ce complexe enzymatique est constitué de deux métalloprotéines de tailles différentes : le site de la réduction du substrat correspondant à la MoFe-protéine ou dinitrogénase (245 KDa) et le donneur d'électrons correspondant à la Fe-protéine ou dinitrogénase réductase (64 KDa).

La Fe-protéine est un dimère de deux sous unités polypeptidiques identiques codé par le gène nif H. Quant à la Mo-Fe-protéine, elle est un tétramère composée de deux sous unités non identiques de type á2â2 (WERNER, 1992 ; HOPKINS, 2003). Celle-ci est codée par les gènes nif D et nif K (Figure 5).

Figure 5 : Nitrogénase et mécanismes d'action (YANN, 2006)

Sous catalyse de ce complexe enzymatique, la réduction de l'azote moléculaire se déroule en deux étapes. Lors de la première, la Fe-protéine est réduite par un donneur primaire d'électrons, habituellement la ferrédoxine. Dans la seconde étape, la Fe-protéine réduite transfère les électrons à la Mo-Fe-protéine qui catalyse à la fois la réduction du diazote gazeux et la production d'hydrogène (HOPKINS, 2003) (Figure 5).

L'ATP dans la réaction provient de la respiration aérobique des bactéroïdes. Il réagit avec la Fe-protéine réduite et intervient dans le transfert des électrons entre la Fe-protéine et la Mo-Fe-protéine. Pour chaque molécule de diazote réduite, au moins 16ATP sont nécessaires, deux par électron (HOPKINS, 2003). Au total, les légumineuses utilisent jusqu'à 22% de l'énergie issue de leur photosynthèse pour réaliser la fixation azotée dont l'équation générale est la suivante:

N2 + 8H+ + 8 e- + 16 ATP 2NH3 + H2 + 16 ADP + 16Pi

À la fin de la réaction, l'ammoniac fixé est converti en glutamine, asparagine, uréides etc. avant d'être transporté dans la sève du xylème pour son assimilation par la plante hôte. Cette conversion est possible grâce aux gènes nif et fix, etc. qui codent en partie pour la synthèse de différents enzymes catalyseurs comme le glutamate déshydrogénase, la glutamine synthétase (GS) etc.

II.1.3- Gènes fix

Les gènes fix sont des gènes additionnels, propres aux fixateurs symbiotiques et impliqués dans les étapes tardives de développement des nodules lors de la fixation symbiotique azotée (BREWIN et al., 1992 ; HOPKINS, 2003 ; NOEL, 2009). Certains de ces gènes (fix L, fix J) sont des régulateurs de la synthèse du gène nif A, intervenant dans la régulation de la synthèse de la nitrogénase (NOEL, 2009). D'autres encore (fix NOPQ) codent pour la synthèse d'enzymes catalysant la régulation de l'oxygène lors de la fixation comme la cbb3 cytochrome oxydase.

Quoique n'étant pas habituellement désignés par le terme de gènes fix, les gènes dct (Dicarboxylate transport genes) épousent la définition des gènes fix. Ils sont nécessaires à l'assimilation par les bactéries des acides dicarboxyliques (succinate, malate) issus des composés carbonés (glucose, fructose) apportés par la plante au cours de la fixation azotée. La mutation de ces gènes chez les bactéries entraîne une faible prolifération des bactéroïdes et une déficience de ceux-ci lors de la fixation de l'azote (NOEL, 2009).

II.2- GENETIQUE DE LA NODULATION CHEZ LA LEGUMINEUSE

Tout comme la bactérie, la plante émet des molécules essentielles à la réalisation de chaque étape du processus de nodulation et de fixation. Ainsi, au début du processus de nodulation, divers composés déterminant une chimiotaxie positive entre les deux symbiotes sont émis par la racine de la légumineuse, parmi lesquels des flavonoïdes. Les flavonoïdes constituent les premiers signaux de l'hôte qui déclenchent chez la bactérie l'expression du gène de régulation de la nodulation nod D et induisent le mécanisme du chimiotactisme des rhizobia (PETERS et VERMA, 1990). La production de ces molécules est limitée à la zone de prolongation des poils racinaires à partir de laquelle la plupart des nodules se développent plus tard (BROUGHTON et al., 2000).

En plus de ces composés émis seuls, la légumineuse participe aussi à la synthèse d'un certain nombre de protéines essentielles au développement de nodules fonctionnels. Il s'agit par exemple de la production des nodulines en réponse à des stimulis provenant des bactéries symbiotiques. Certaines de ces nodulines sont des enzymes du métabolisme azoté (glutamine synthétase, etc.) ou carboné (saccharose synthase, etc). La plus connue est une protéine (la globine) qui, associée à l'hème produit par les bactéroïdes, constitue la leghémoglobine, protéine fixatrice d'oxygène. Cette dernière protéine est indispensable à la fixation du N2 (PELMONT, 1995). En effet, la nitrogénase étant extrêmement labile en présence de O2, la leghémoglobine est produite autour des symbiosomes pendant la fixation de l'azote afin de maintenir une pression partielle basse en oxygène nécessaire à son bon fonctionnement, tout en assurant aux bactéroïdes un approvisionnement suffisant en oxygène pour leur respiration (WERNER, 1992 ; DAVET, 1996 ; OTT et al., 2005).

En somme l'effet conjugué de tous les gènes et facteurs de nodulation de la bactérie et de la plante aboutissent à la formation de nodules fixateurs d'azote. Ce processus complexe est résumé dans le paragraphe suivant par un schéma.

II.3- SCHEMATISATION DES ETAPES DU PROCESSUS DE NODULATION

En général, la formation d'une nodosité fixatrice d'azote suit les étapes de développement suivant :

A - chimiotactisme et attachement des rhizobiums aux racines de l'hôte ;

B- déformation des poils absorbants ;

C- invasion du cytoplasme des cellules corticales par les bactéries à travers les cordons d'infection ;

D- division des cellules du cortex aboutissant à la formation d'un primordium nodulaire ;

E- différentiation des bactéries en bactéroïdes et du primordium nodulaire en nodosité

F- fixation de l'azote par la bactéroïde (Figure 6).

Figure 6 : Etapes du processus de nodulation lors de la symbiose Légumineuses-Rhizobia

 

A. Les rhizobia (rh) colonisent la rhizosphère et s'attachent aux poils absorbants (r).

B. Les bactéries induisent la déformation du poil en crosse de berger et initient un cordon d'infection (it) au centre de la courbure à partir d'un centre infectieux (ci).

C. Le cordon s'allonge et atteint la base de la cellule épidermique.

D. Le cordon se ramifie (rit) à l'approche du primordia nodulaire formé suite à la division des cellules du cortex (c).

E. Les bactéries sont relâchées dans les cellules du nodule et forment des symbiosomes, où elles se différencient en bactéroïdes fixateurs. Des granules de PHB s'accumulent dans les bactéroïdes entourés d'une membrane péribactéroïdienne.

F. Fixation de l'azote et transport de l'ammonium dans le symbiosome. La leghémoglobine maintient une

concentration basse en oxygène permettant le fonctionnement de la nitrogénase qui transforme l'azote en ammoniac dans le bactéroïde. L'ammoniac diffuse dans l'espace péribactéroïdien où il est transformé en ammonium qui est ensuite exporté dans le cytoplasme végétal via un canal et assimilé en glutamine par la plante. L'ammoniac peut aussi être assimilé au niveau du bactéroïde dans des acides aminés ensuite exportés vers le cytoplasme végétal.

r, poil absorbant ; rh, rhizobium ; ep, épiderme ; c, cortex ; it, cordon d'infection ; n, noyau ; ci, centre infectieux ; rit, ramifications du cordon d'infection ; ed, endoderme ; b, bactéroïdes ; pb, membrane péribactéroïdienne ; s, symbiosome ; d, vacuole ; phb, poly beta-hydroxybutarate ; ETC, Electron transport chain ; PBS, espace péribactéroïdien.

 

AE: PERRET et al., 2000; F: d'après DAY et al., 2001

CHAPITRE III : TAXONOMIE DES RHIZOBIA

 

III.1- HISTOIRE DE LA TAXONOMIE RHIZOBIENNE

La présence de nodosités chez les légumineuses était historiquement bien connue, mais leur origine était controversée. WORONIN (1866)3(*) fut le premier à signaler l'observation de micro-organismes ressemblant à des bactéries dans les nodosités de Lupinus mutabilis. En 1879, FRANK4(*), un microbiologiste allemand, rapporta que ces micro-organismes étaient des champignons en leur affectant le nom de Schinzia leguminosarum. En 1888, les chimistes allemands HELLRIEGEL et WILFARTH5(*) établissaient un raccordement important entre les plantes légumineuses, les nodules des racines et la fixation symbiotique de l'azote. Ils démontrèrent que l'aptitude à utiliser l'azote atmosphérique par les plantes légumineuses est liée au développement des nodules suivant l'infection des racines par des microorganismes du sol. La même année, la première partie de l'histoire de l'étude des nodules racinaires connut son apogée, quand BEYERINCK6(*)  devint le premier à isoler une bactérie capable de noduler une légumineuse qu'il nomma Bacillus radicicola. En 1889, non convaincu par la nomenclature donnée par BEYERINCK, FRANK7(*) renomma la bactérie identifiée Rhizobium leguminosarum. Il décida par ailleurs que toutes les bactéries qui seront ultérieurement isolées des nodules des légumineuses porteront ce même nom (NOEL, 2009). Plus tard (1929), BALDWIN et FRED ont rapporté que la classification des différents rhizobiums devrait être basée sur la spécificité de l'espèce bactérienne par rapport à la plante hôte : c'est le concept de spécificité d'hôte.

Par la suite, FRED et certains collègues proposèrent le concept d'inoculation croisée qui fut défini comme un test pour vérifier si une bactérie isolée d'une espèce de légumineuse donnée peut induire des nodules chez d'autres espèces. Ce test permit de définir des groupes de légumineuses dits d'inoculations croisées, qui d'après FRED et al. (1932) sont « des groupes de plantes entre lesquelles les organismes présents dans les nodules sont mutuellement interchangeables ». Ainsi, FRED et al. (1932) ont pu identifier six groupes d'inoculations croisées : R. leguminosarum pour Lathyrus, Pisum, Vicia et Lens ; R. trifolii pour Trifolium ; R. phaseoli pour Phaseolus ; R. meliloti pour Glycine max et R. lupini pour Lupinus.

Si ce concept se révéla très utile en agriculture, il n'en demeure pas moins qu'il présenta rapidement des limites dans la classification bactérienne (WILKSON, 1944). En effet, ce concept se montra très limité dans l'exploration de la diversité des souches rhizobiennes et dans l'établissement des relations existantes entre celles-ci (NOEL, 2009).

Par la suite, les bactéries vont être classées sur la base de leur temps de génération et leur vitesse de croissance sur milieu de culture, tels que définis par LÖNHIS et HANSEN en 1921. Ainsi, utilisant ce concept, JORDAN (1982) classa pour la première fois, les bactéries symbiotiques en deux genres : le genre Rhizobium correspondant aux souches à croissance rapide et le nouveau genre Bradyrhizobium pour les souches à croissance lente.

Toutefois, les observations discordantes entre la notion de vitesse de croissance des bactéries et la gamme d'hôte ont jeté le doute sur la validité de cette nouvelle classification. Celle-ci fera par ailleurs place à des méthodes comparatives comme la sérologie, le coefficient de Chargaff, l'hybridation ARN / ADN ou ADN / ADN, l'analyse des plasmides etc. Cette ère marqua le début d'une nouvelle taxonomie basée sur la comparaison des résultats de différentes analyses phénotypiques et biochimiques dans l'identification des bactéries symbiotiques. Cette taxonomie fut connue sous le nom de taxonomie polyphasique, terme initié en 1970 par COLWELL.

III.2- TAXONOMIE POLYPHASIQUE ET PHYLOGENIE DES RHIZOBIA

III.2.1- Taxonomie polyphasique

Originellement basée sur des critères phénotypiques, l'application de la terminologie polyphasique va être révisée grâce à la révolution de différentes techniques moléculaires dont principalement la Réaction de Polymérisation en Chaîne ou PCR (MULLIS et FALOONA, 1987). Ainsi, il fut proposé en 1991 les principes standards de la description de nouveaux genres ou espèces sur la base de l'analyse numérique qui est la synthèse des résultats de différents tests phénotypiques et moléculaires (GRAHAM et al., 1991). Cette nouvelle définition de l'approche polyphasique a permis l'étude systématique appropriée de grands groupes bactériens, l'évaluation de la résolution taxonomique de différentes techniques d'études de diversité (VANDAMME et al., 1996) et l'établissement de bases de données comparables entre différents laboratoires de microbiologie appliquée (GILLIS et al., 2001).

III.2.2 - Notion de phylogénie chez les Rhizobia

La comparaison des données obtenues sur les souches ou les espèces bactériennes par différentes approches moléculaires permet l'identification de groupes ou de taxons. Les différents taxons obtenus peuvent être comparés et utilisés pour le traçage de lignées de filiation reconnues communément sous le nom d'arbre phylogénétique. Ainsi, la phylogénie peut se définir comme l'histoire évolutive qui révèle les rapports existants entre un groupe d'organismes avec un ancêtre situé à un plus haut niveau taxonomique.

De nos jours, les relations phylogénétiques établies entre les rhizobia sont basées principalement sur la comparaison des séquences de l'ADN ribosomique 16S (OLSEN et al., 1994 ; YOUNG et HAUKKA, 1996 ; TEREFEWORK, 2002). Par ailleurs, selon une analyse phylogénétique basée sur le gène de l'ARN 16S, les rhizobia sont dispersés dans 12 genres parmi neuf groupes monophylogénétiques (SAWADA et al., 2003). Tous ces rhizobia caractérisés sont des bactéries Gram-négatives, présentes dans le sol et appartenant aux sous-classes alpha (á) et beta (â) des Protéobactéries. La plupart des espèces se trouvent dans la sous-classe á, divisée en sept groupes monophylogénétiques (Annexe 1)

- Rhizobium et Allorhizobium ;

- Sinorhizobium (et Ensifer) ;

- Mesorhizobium ;

- Bradyrhizobium ;

- Methylobacterium (JAFTHA et al., 2002 ; SY et al., 2001) ;

- Azorhizobium ;

- Devosia (RIVAS et al., 2002).

Dans la sous classe â, les rhizobia sont présents dans deux groupes monophylogénétiques suivants :

- Burkholderia (MOULIN et al., 2001) ;

- Ralstonia (CHEN et al., 2003).

En somme, la taxonomie bactérienne moderne vise l'intégration de toutes les données phénotypiques, génotypiques et phylogénétiques pour avoir une classification plus stable (ZAKHIA et DE LAJUDIE, 2001; VANDAMME et al., 1996). Le paragraphe suivant traitera de la classification actuelle des rhizobia avec cette nouvelle approche.

III.3 - CLASSIFICATION ACTUELLE DES RHIZOBIA

La combinaison d'études polyphasiques et phylogénétiques a permis de modifier considérablement la taxonomie des rhizobia ces dernières années. Le tableau II présente la diversité des rhizobia identifiés à partir de cette nouvelle approche en 2006.

Tableau II : Classification des rhizobia (D'après NOEL, 2009)

Protéobactéries

Espèces

Division

Genre

Nombre

Représentatives

Hôtes représentatives

Alpha

Rhizobium

16

R. leguminosarum

R. etli

R. tropici

Psivum, Trifolium etc.

Phaseolus

Phaseolus, leucaena

Bradrhyzobium

7

B. japonicum

B. elkanii

Glycine, Vigna

Glycine

Sinorhizobium (Ensifer)

11

S. eliloti

S. fredii

Medicago

Glycine, Vigna

Azorhizobium

2

A. caulinodans

Sesbania

Mesorhizobium

11

M. loti

Lotus spp.

(Allorhizobium)

1

A. undicola

Neptunia

Methylobacterium

1

M. Nodulans

Crotalaria Spp.

Devosia

1

D. neptuniae

Neptunia

Ochrobacterium

1

O. lupinus

Lupinus

Phyllobacterium

1

P. lupinii

Trifolium et Lupinus

Beta

Burkholderia

5

B. phymatum

Mimosa

Cupriavidus (Ralstonia)

2

C. taiwanensis

Mimosa

Au total, 59 espèces de rhizobia réparties en 12 genres et appartenant aux sous-classes alpha (10 genres) et beta (2 genres) des Protéobactéries ont été identifiées depuis 2006 (NOEL, 2009). Ces espèces se répartissent également en huit familles (Rhizobiacées, Phyllobacteriacées, Bradyrhizobiacées, Hyphomicrobiacées, Methylobactériacées, Brucellaceés, Burkholderiacées et Ralstoniacées) et deux ordres, à savoir les Rhizobiales et les Burkholderiales. L'ordre des Rhizobiales renferme les six premières familles.

CONCLUSION PARTIELLE

La taxonomie des rhizobia a changé significativement ces dernières années avec le développement des nouvelles techniques d'études. Toutefois, cette taxonomie restera toujours dynamique car bien que les rhizobia soient étudiés depuis plus de 100 ans, des symbiotes ont été identifiés pour moins de 10 % des 720 genres de légumineuses. Ainsi, il est probable qu'avec ces nouveaux outils d'étude, de nouveaux genres de rhizobia soient découverts parmi les sous-classes alpha et beta des Protéobactéries et peut-être même parmi d'autres taxons (VERNIE, 2008). Pour le pois d'Angole qui est `` une culture négligée en termes de recherche '' (MINJA, 2001), cette probabilité peut être même élevée.

CHAPITRE IV : GENERALITES SUR LE POIS D'ANGOLE (Cajanus cajan L.)

 

Ces généralités portent sur l'origine, la distribution géographique et la taxonomie de C. cajan. Elles font également la description botanique de la plante et donnent ses intérêts.

IV.1 - ORIGINE ET DISTRIBUTION GEOGRAPHIQUE DE LA PLANTE

Le pois cajan ou pois d'Angole est la seule espèce domestiquée du genre Cajanus qui en compte 34 (VAN DER MAESEN, 2006). Il est originaire de l'Inde et résulterait de l'hybridation interspécifique entre ses parents proches sauvages que sont C. cajanifolia et C. scarabaeoides (NADIMPALLI et al., 1992). L'Inde serait son centre de domestication qui aurait lieu un peu plus de 2000 ans avant J.C. Après sa domestication, le pois d'Angole a été introduit successivement en Malaisie, en Afrique de l'Est puis en Egypte à travers la vallée du Nil. Par la suite, il a été introduit en Afrique de l'ouest, en l'an 2000 avant J.C (VAN DER MAESEN, 1990). On estime que, préalablement à la traite négrière, sa culture a été exportée de la République démocratique du Congo et de l'Angola vers le nouveau monde (Amérique) (VAN DER MAESEN, 1986). Plus tard, la traite négrière l'a introduite aux Antilles où il a été nommé pois des pigeons en 1962 (VAN DER MAESEN, 1986).

IV.2 - ZONES DE CULTURE ET IMPORTANCE DES PRODUCTIONS

Aujourd'hui, le pois d'Angole est présent sous tous les tropiques et occupe plus de 4 millions d'hectares dans le monde. Mais, sa culture est mieux adaptée et plus productive sous les tropiques semi-arides. Il est particulièrement cultivé dans le sous-continent indien où sa production représente plus de 70% de la production mondiale (FAOSTAT, 2007). Le Sud et l'Est du continent africain, particulièrement le Kenya, le Malawi, la Mozambique, la Tanzanie et l'Ouganda, constituent sa deuxième plus grande zone de culture (SINGH, 1991). Les autres zones de production d'importance sont le sud-est du continent asiatique, l'Afrique centrale et de l'ouest et enfin le continent américain (NENE et SHEILA, 1990).

Selon les statistiques de la FAO, la production mondiale de pois cajan entre 1999 et 2003 s'élevait à 3,1 millions de tonnes par an sur 4,3 millions d'hectares (ha) de culture. L'Inde (principal pays producteur) avait une production de 2,5 millions de tonnes (t) sur 3,4 millions d'ha. Les principaux pays producteurs d'Afrique ont été le Malawi (79 000 t), l'Ouganda (78 000 t), le Kenya (59 000 t), la Tanzanie (47 000 t) (VAN DER MAESEN, 2006).

IV.3 - TAXONOMIE DU POIS D'ANGOLE

IV.3.1 - Nomenclature

Le nom scientifique du pois d'Angole est Cajanus cajan (L.). Plusieurs synonymes de ce nom existent. Ce sont Cajanus bicolor DC., Cajanus flavus DC., Cajanus indicus Spreng et Cystisus cajan L. Il existe aussi une multitude de noms communs utilisés pour désigner la plante selon les pays et les langues (tableau 3).

Tableau III : Noms communs du pois d'Angole en quatre langues principales

Langues

Noms communs

Anglais

Congo pea, pigeon pea, redgram, yellow dahl

Français

ambrevade, pois d'Angole

Inde

arhar, tuver

Espagnol

cachito, gandul

IV.3.2- Classification

Cajanus cajan est la seule espèce domestiquée dans la sous-tribu des Cajaninae de la tribu des Phaseolae Benth., appartenant à la sous-famille des Papilionoidae et à la famille des Leguminosae (BENTHAM, 1865). Sa classification entière est ci-dessous donnée:

Règne : Végétaux (Plantae)

Embranchement : Spermaphytes (Spermaphyta)

Sous-embranchement : Angiospermes (Magnoliophyta)

Classe : Dicotylédones (Magnoliopsida)

Ordre : Fabales (Léguminosales)

Famille : Fabacées (Leguminosae)

Sous-famille : Papilionoideae (Faboideae),

Tribu : Phaseoleae Benth. (Phaséolidées)

Sous-tribu : Cajaninae Benth.

Genre : Cajanus

Espèce: C. cajan

(L.) Millspaugh.

Il existe deux variétés «traditionnelles'' au sein de l'espèce C. cajan (NIYONKURU, 2002). Il s'agit d'une part de Cajanus cajan var. bicolor. Cette variété est pluriannuelle et caractérisée par des fleurs jaunes et rouges avec de longues gousses (5-7 graines). La deuxième variété, Cajanus cajan var flavus, est à floraison précoce et cultivée en plante annuelle. Elle est identifiable par ses fleurs jaunes et ses gousses plus courtes (3 graines).

De nombreuses variétés sélectionnées par l'ICRISAT (Institut international de recherche sur les plantes cultivées des zones tropicales semi-arides) sont également cultivées. Ce centre est basé en Inde (VAN DER MAESEN, 2006).

IV.4- DESCRIPTION DU POIS D'ANGOLE

IV.4.1- Description botanique

Le pois d'Angole est un arbuste dont la durée de vie en culture varie entre 3 et 5 ans. Son port érigé atteint 4 m de hauteur avec des racines atteignant 2 m de profondeur (DUKE, 1981 a).

Sa tige, qui peut avoir 15 cm de diamètre dans sa partie basale, porte de nombreuses branches et brindilles. Ces dernières supportent un feuillage abondant de couleur vert-clair ou vert-jaune et formé de feuilles trifoliolées. Les feuilles sont disposées en spirales sur les tiges.

Les inflorescences sont des racèmes de 4 à 12 cm de long situés aux extrémités des branches et comportant 6 à 12 fleurs. Les fleurs ont quatre lobes de calices séparées. Les pétales ont une couleur qui évolue du jaune au rouge-pourpre (Figure 7 a) (BORGET, 1989).

Le fruit est une gousse linéaire-oblongue de 4 à 10 cm et renfermant des graines arrondies. Les gousses, de couleur crème, sont comestibles, déhiscentes à maturité et ont un hile foncé avec une extrémité en bec. Le nombre de graine par gousse varie de 2 à 8, avec la couleur du tégument allant du blanc, blanc-brun, beige, marron, rougeâtre au tacheté (Figure 7 b) (SEDGA, 1997; NIYONKURU, 2002).

Figure 7 a : Inflorescences de Cajanus cajan Figure 7 b : Fruit sec en déhiscence

IV.4.2 - Ecologie

En culture, le pois cajan peut supporter des sécheresses allant jusqu'à cinq (5) mois, tolère les sols salés ainsi que les sables aux argiles lourds. Il préfère un pH de 5 à 7, mais peut tolérer un pH allant de 4,5 à 8,4 (DUKE, 1981a ; VAN DER MAESEN, 2006).

Ses pluviométries optimales sont comprises entre 600 et 1000 mm de pluie par an. Toutefois, il se développe bien dans les zones semi-arides et les zones humides avec des pluviométries atteignant respectivement 400 et 2500 mm par an (BARTHOUX, 1975).

Cajanus cajan L. se développe mieux en pleine lumière du soleil mais peut tolérer un faible ombrage. Cependant, il est très sensible au bas rayonnement qui engendre une production médiocre de graines (SPORE, 2010).

La plante se développe dans des conditions chaudes avec températures optimales comprises entre 17 et 28°C. Lorsque la température dépasse 35°C, elle souffre et l'on constate la chute des fleurs et des gousses (SPORE, 2010).

IV.4.3 - Mode de multiplication et systèmes de culture

La culture du pois cajan se fait généralement à partir des grains et par semis direct (BORGET, 1989). Les traitements de pré-germination des grains avant le semis ne sont pas nécessaires et la profondeur de semis varie de 2,5 à 5 cm. Quant à la densité de semis, il dépend du système de culture. Pour une jachère améliorée, il faut observer un espacement de 1 m x 1,50 m, contre 3 m x 3 m si la culture vise la production de grains (SKERMAN, 1982). Le nombre de grains recommandé par poquet est d'au moins deux.

En Afrique et en Inde, le pois cajan se cultive souvent en association, avec des céréales, mais également avec le manioc et le cotonnier. Il est bien adapté aux systèmes de cultures associées en raison de sa croissance initiale lente, qui réduit la compétition avec la plante qu'il accompagne, et de sa maturité tardive, qui permet d'étaler les besoins de main d'oeuvre au moment de la récolte (VAN DER MAESEN, 2006).

IV.4.4 - Croissance, développement et rendement

La germination des grains de pois cajan semés a lieu 2 à 3 jours après semis (JAS), à des températures comprises entre 19 et 43°C. La levée est complète 2 à 3 semaines après le semis et le développement végétatif, qui débute lentement, s'accélère après 2 à 3 mois.

En général, la floraison (de 50% des plantes) commence 56 à 210 jours après le semis et la maturité de la graine est atteinte entre 95 et 260 jours. Toutefois, la durée totale du cycle de production est fonction des cultivars. En Inde par exemple, on distingue 10 groupes de cultivars, que l'on combine d'ordinaire en quatre catégories : les cultivars à maturité extra précoce, précoce, moyenne et tardive (120, 145, 185, et plus de 200 JAS respectivement).

Dans des conditions optimales de culture et en culture pure, les rendements en grains du pois cajan peuvent atteindre 5000 kg/ha. Toutefois, les rendements sont en général faibles (600kg/ha en moyenne en Afrique) et cela est dû en partie qu'une part considérable des grains est récoltée et consommée avant la maturité. Les rendements en fourrage de la plante sont de l'ordre de 3-8 t/ha. Comme combustible, on obtient généralement 7-10 t/ha, mais des rendements atteignant 30 t/ha ont été déjà enregistrés (VAN DER MAESEN, 2006).

IV.4.5 - Ennemis et maladies de Cajanus cajan

La maladie la plus importante du pois d'Angole est le flétrissement fusarien causé par Fusarium udum et présente dans toutes les grandes régions de culture (NIYONKURU, 2002). La forte humidité des sols favorise l'installation de l'agent pathogène qui infecte les vaisseaux des racines et des tiges et cause leur dessèchement progressif. Le virus de la mosaïque et de la stérilité du pois cajan (PPSMV) constitue tout de même sa principale maladie en Inde (VAN DER MAESEN, 2006). Les plantes atteintes par cette maladie présentent sur les feuilles, des symptômes caractéristiques de la mosaïque avec réduction ou absence de floraison (stérilité). Les baisses de rendement observées peuvent atteindre dans certains cas, plus de 90% (KANNAIYAN et al., 1984).

Parmi les ravageurs, les borers des gousses restent de loin les plus dangereux. Ces chenilles foreuses (Helicoverpa armigera, Maruca testutalis et Laspeyresia ptychora) peuvent dans certaines circonstances provoquer jusqu'à 80% de pertes. Elles sont d'ailleurs souvent précédées de punaises suceuses (Clavigralla tomentosicolis et Nezara viridula).

D'autres dégâts sont également causés par les nématodes, notamment les nématodes à galles (Meloidogyne spp.) et les nématodes réniformes (Rotylenchus spp.).

La lutte contre ces nuisibles repose sur l'utilisation de variétés résistantes, les rotations culturales ainsi que l'utilisation de produits chimiques (VAN DER MAESEN, 2006).

IV.5 - IMPORTANCE DE LA CULTURE DU POIS CAJAN

Le pois cajan est une importante légumineuse à grains de la tribu des Phaseoleae tout comme les genres Phaseolus et Vigna (VAN DER MAESEN, 1990). Les intérêts de sa culture se situent à plusieurs niveaux : alimentation humaine et animale, agriculture, médecine etc.

IV.5.1 - Importance nutritionnelle du pois cajan

Le pois cajan est principalement cultivé pour ses grains dont la valeur nutritive est comparable à celle du haricot commun (Phaseolus vulgaris) (NIYONKURU, 2002). En effet, connus pour être une excellente source de protéines (21,7%), les grains mûrs du pois cajan sont une bonne source d'énergie (343 kcal par 100 g de partie comestible), de vitamines (A 28 UI, B6) et d'acides aminés essentiels (lysine, phénylalanine, valine, leucine et isoleucine). Les grains sont également riches en acides gras dont les principaux sont l'acide linoléique et l'acide palmitique (USDA, 2004 ; VAN DER MAESEN, 2006). La consommation de ces grains est surtout importante dans les pays tropicaux en développement (Inde, Kenya etc.).

En alimentation animale, le feuillage coupé constitue, frais ou conservé, un bon fourrage servant à nourrir le bétail. En effet, les feuilles sont riches en protéines (21-25%/Matière Sèche (MS)) et en fibres (30-35% de cellulose brute/MS) (GRIMAUD, 1988). Pour les animaux de pâturage, l'on peut réaliser des coupes tous les deux ou trois mois avec une productivité de 1,5 à 3,5 t de MS/ha/par coupe et une valeur azotée de 100 à 120 g de Matière Azotée Digestible (MAD)/100 kg de matière sèche (ANONYME, 2002). Par ailleurs, des essais, conduits en station, ont montré qu'une introduction de graines de pois cajan ayant subi un broyage comme seule transformation dans l'aliment des porcs et des volailles n'entraînait aucun trouble de croissance chez ceux-ci. Les pourcentages d'incorporation pouvant être atteints sont de 15% chez le porc à l'engrais et 25% à 30% chez le poulet de chair (GRIMAUD, 1988).

IV.5.2 - Importance agronomique du pois cajan

Le pois cajan offre de nombreux avantages aux agriculteurs à faibles ressources y à savoir du combustible, du matériel de clôture, l'amélioration de la fertilité et le contrôle de l'érosion des sols (SIAMBI et al., 1992). Il peut aussi être utilisé comme brise-vent et comme plante de couverture dans certaines plantations de cultures industrielles, notamment celles du caféier (BARRIOS et al., 1997 ; BASHIR et al., 1998). Egalement, grâce à son système racinaire étendu, à l'azote atmosphérique qu'il fixe et au mulch que procurent ses feuilles rejetées durant sa culture (Figure 8), le pois cajan améliore significativement la fertilité des sols (VAN DER MAESEN, 2006). A titre d'exemple, la plante peut fixer jusqu'à 235 kg d'azote par hectare de culture et s'avère de ce fait très intéressante pour une agriculture protectrice de l'environnement (PEOPLES et al., 1995). Quant aux résidus d'azote laissés par culture, ils avoisinent 40 kg/ha (VAN DER MAESEN, 2006) ; ce qui renforce la fertilité des sols pour les cultures en rotation.

Figure 8 : Feuillage rejeté par une culture de pois cajan en jachère améliorée

(TA BI, 2010)

IV.5.3 - Importance du pois cajan en Afrique

En Afrique, le pois d'Angole est une plante de très grande importance notamment en alimentation humaine et animale. Dans le Nord-est de la Côte d'Ivoire, ses grains constituent pour les populations locales, en l'occurrence les Koulango et les Abrons, un aliment de soudure (NDABALYSHE, 1995). Elle est utilisée pour la complémentation animale (bovins, caprins etc.), surtout en saison sèche et sert de matériaux pour la reconstitution des pâturages dans les îles du Cap Vert (LEPAPE, 1980). Cajanus cajan est par ailleurs utilisé comme plante améliorante des jachères en agroforesterie en Zambie (BOEHRINGER et CADWEL, 1989). Toujours sur le continent, son association avec le maïs dans plusieurs programmes d'expérimentation, a donné des résultats intéressants. Au Malawi par exemple, le rendement du maïs, cultivé en rotation avec le pois cajan, a accru de 2,8 kg/ha par rapport à sa culture continue recevant 35 kg N/ ha (MACCOLL, 1989). Au Nigeria, des études similaires ont montré une augmentation de 50% du rendement du maïs par rapport à sa culture sans engrais (HULUGALLE et LAL, 1986). Par ailleurs, C. cajan fait partie des plantes de couverture les mieux adoptées au Bénin dans la lutte contre Imperata cylindrica, en raison de l'exploitation supplémentaire de son bois, ses graines et ses feuilles comestibles (VISSOH et al., 2004).

CONCLUSION PARTIELLE

En somme, le pois cajan est une légumineuse de grand intérêt aussi bien pour l'alimentation humaine, animale que pour la pratique agricole. Le chapitre suivant fait une synthèse des rhizobia identifiés jusqu'à ce jour comme ses symbiotes pour la fixation azotée.

CHAPITRE V : RHIZOBIA SYMBIOTIQUES DU POIS CAJAN

 

Les travaux de recherche effectués sur les bactéries nodulant le pois d'Angole ont permis d'identifier trois genres symbiotiques. Il s'agit premièrement du genre Rhizobium. En effet, on a isolé Rhizobium IHP 100 des nodules de Cajanus cajan (BENDER et al., 1986). Par l'étude du polymorphisme de la longueur des fragments de restriction (RFLP) des gènes de l'ARNr 16S, de l'ARNr 23S, de l'espace intra-génique transcrit (ITS) 16S-23S amplifiés ainsi que par le séquençage partiel de l'ARNr 16S, il a été confirmé en Ethiopie que ce genre est effectivement symbiote du pois cajan (WOLDE-MESKEL et al., 2004 a).

En 1988, deux espèces bactériennes du genre Sinorhizobium (S. fredii et S. xinjiangense) furent également identifiées comme symbiotes du pois cajan à partir de travaux menés en Chine (CHEN et al., 1988). Sinorhizobium fredii fut identifié à partir d'un test d'hybridation ADN-ADN et de quelques tests physiologiques. Quant à S. xinjiangense, il fut identifié à partir d'une analyse numérique de 240 différents caractères (CHEN et al., 1988).

En 1981, il a été observé que des souches de Bradhyrizobium isolées des nodules du niébé (Vigna sp.) au Nigeria nodulaient le pois cajan (AHMAD et al., 1981 a, 1981 b). Par ailleurs, des travaux plus récents ont permis de confirmer que le pois cajan est l'hôte de certaines souches de Bradyrhizobium. La technique du polymorphisme de la longueur des fragments de restriction de l'ADNr 16S a été couplée à une amplification aléatoire des fragments d'ADN digérés pour obtenir ces résultats. Il s'agit de la souche B. spp. TAL 1039 isolée au Kenya (ABAIDOO et al., 2000) et des souches B. spp. TAL 36 et B. spp. TAL 191 isolées au Nigeria (ABAIDOO et al., 2000). Egalement, l'étude de la diversité de 30 isolats de rhizobia à croissance lente nodulant le pois d'Angole, a montré que 16 d'entre eux étaient phylogénétiquement proches du rhizobia à croissance lente, Bradyrhizobium elkanii, nodulant le soja (RAMSUBHAG et al., 2002). L'analyse numérique de 80 traits phénotypiques et le séquençage partiel de l'ARNr 16S ont permis d'aboutir à ces résultats. Toutefois, seulement 3 de ces 16 isolats ont été capables de noduler le soja. Enfin, la PCR-RLFP du gène de l'ARNr 16S et 23S, de l'ITS 16S-23S ainsi que le séquençage partiel de l'ARNr 16S ont permis d'identifier Bradyrhizobium japonicum comme symbiote de Cajanus cajan (WOLDE-MESKEL et al., 2004 a).

En somme, l'émergence de techniques moléculaires d'identification telles que la PCR-RFLP et le séquençage de l'ADNr 16S, ont permis ces dernières années de mieux explorer la diversité génétique des rhizobia symbiotes du pois cajan à travers le monde.

DEUXIEME PARTIE :

ETUDE EXPERIMENTALE

 
 

CHAPITRE VI : PRESENTATION DE L'ETUDE ET DES LABORATOIRES D'ACCUEIL

VI.1- OBJECTIFS DE L'ETUDE

Dans cette étude, on évalue la diversité génétique des rhizobia associés à des plants de pois d'Angole issus d'un champ cultivé à Yamoussoukro. Il s'agit à partir de nodosités prélevées :

- d'isoler les bactéries symbiotiques ;

- de les mettre en culture et les purifier ;

- de révéler la diversité génétique de ces bactéries à partir d'une PCR-RFLP ;

- et enfin, de constituer une collection de celles-ci et les conserver.

VI.2- PRESENTATION DU SITE DE COLLECTE DES ECHANTILLONS

Le matériel vivant utilisé (rhizobia) a été collecté à partir de jeunes plants de Cajanus cajan (4 à 14 mois) issus d'un champ cultivé à l'INP-HB. Ce champ, d'une superficie totale d'environ 1,5 ha, est la propriété du directeur des études du cycle des ingénieurs agronomes de l'Ecole Supérieure d'Agronomie (ESA). Il l'a mis en place en vue de produire des grains de pois cajan pour l'alimentation de sa volaille. Le champ est localisé à droite du chemin menant à l'ESA via le garage de l'INP Centre, précisément à 100 m dudit garage.

VI.3- PRESENTATION DES LABORATOIRES D'ACCUEIL DE L'ETUDE

Le principal laboratoire d'accueil de l'étude est celui d'Agronomie et Productions Végétales de l'Institut National Polytechnique Félix Houphouët Boigny (INP-HB) de Yamoussoukro (Annexe 2). Ce laboratoire a servi à l'isolement, la culture et la purification des souches rhizobiennes. L'analyse moléculaire de ces isolats a eu lieu au Laboratoire Central de Biotechnologie (LCB) du Centre National de Recherche Agronomique (CNRA) d'Abidjan-Adiopodoumé, précisément au sein de l'unité de virologie et de biologie moléculaire (Annexe 2).

CHAPITRE VII : MATERIEL ET METHODES

 

VII.1- MATERIEL

VII.1.1 - Matériel vivant

Le matériel vivant utilisé est constitué de 169 souches de rhizobia isolées d'environ 200 nodosités collectées. Les figures 9 a et 9 b suivantes présentent respectivement quelques nodosités sur racines et des nodosités préparées en vue de l'isolement des bactéries.

Figure 9 a: Nodosités sur racines de C. cajan Figure 9 b: Nodosités étalées pour l'isolement

VII.1.2 - Matériel technique

Le matériel technique utilisé dans cette étude est constitué de plusieurs équipements de laboratoire et des kits de réactifs. En effet, pour l'isolement, la culture et la purification des bactéries au Laboratoire de Productions Végétales de l'INPHB, un kit de réactif pour milieu TY (Tryptone Yeast Extract), des tubes Eppendorf et plus d'une centaine de boîtes de pétri ont été utilisés. Au LCB du CNRA d'Adiopodoumé, la constitution de la collection locale de rhizobia a nécessité 2 plaques à 96 puits chacune et du glycérol. La PCR a été possible grâce à un kit PCR contenant des amorces spécifiques à l'ADNr 16S des rhizobia, une enzyme de polymérisation (la Taq DNA polymérase) et divers appareils de laboratoire. Le thermocycleur est le plus important de tous ces appareils (figure 10 a). Celui-ci est muni d'un bloc thermique de 96 puits (figure 10 b) où l'on peut insérer les tubes contenant le mélange réactionnel de la PCR. Il est aussi équipé d'un couvercle qui pressant sur les capuchons des tubes, permet d'éviter l'évaporation du mélange réactionnel. Un clavier composé de quelques touches et un écran à cristaux liquides permettent d'entrer des programmes PCR dans la mémoire de la machine. Dans notre cas, nous avons utilisé un thermocycleur de type BIOMETRA UNO II.

(a) : Vue générale (b) : Bloc thermique

Figure 10 : Présentation d'un thermocycleur (Photos AVO, 2010)

Les autres appareils de laboratoire sont constitués d'une centrifugeuse utilisée pour séparer la phase aqueuse (le surnageant) du culot des bactéries cultivées sur milieu TY liquide. Il y a également un bain-marie servant à faire le choc thermique des bactéries afin d'avoir accès à quelques fragments d'ADN pour l'amplification. On cite aussi une machine à glace nécessaire pour la conservation des réactifs lors de la préparation de la solution réactionnelle, une micro-onde idéale pour la préparation de gel d'agarose et un appareil Mupid-One (figure 11) pour les migrations électrophorétiques. Un transilluminateur à caméra relié à un ordinateur (figure 12) muni du logiciel AlphaDigiDoc a permis de visualiser les fragments d'ADN après un temps de migration.

Figure 11: Appareil de migration Figure 12 : Transilluminateur relié à un ordinateur

(Photo AVO, 2010) (Photo AVO, 2010)

Les fragments amplifiés ont été digérés dans le bain-marie grâce à une enzyme de restriction, la Tsp 509I -R0576S. Pour la migration et la visualisation des résultats de cette digestion, les mêmes appareils ayant permis d'observer les résultats de la PCR ont été utilisés.

VII.2- METHODES

Les méthodes évoquées ici sont celles de la récolte des nodules, de l'isolement, la culture et la purification des bactéries, de l'amplification du gène cible ADNr 16S ainsi que de sa digestion pour évaluer la diversité génétique des bactéries. La méthode de constitution de la collection locale des bactéries est également exposée.

VII.2.1 - Récolte des nodules et isolement des souches bactériennes

Les nodules ont été récoltés au champ à l'aide d'une tarière. Des tubes Ependorf de 15 ml, remplis d'eau à moitié, ont servi à maintenir hydratés les nodules afin d'assurer la survie des bactéries. Au laboratoire, leur isolement a suivi le protocole suivant:

- les nodules ont été lavés avec de l'eau distillée pour enlever toute trace de terre ;

- chaque nodule lavé superficiellement avec l'eau distillée a été désinfecté par trempage dans de l'eau de javel pendant une trentaine de secondes ;

- après ce bref temps, l'eau de javel a été immédiatement éliminée par une série de rinçages des nodules avec de l'eau distillée stérile ;

- les nodules ont été ensuite étalés un à un, sur des gouttes d'eau dans des boîtes de pétri ;

- emmenés sous une hotte, ils ont été écrasés au moyen de cônes préalablement stérilisés à 120°C pendant 2 heures;

- l'isolement des bactéries a été réalisé par prélèvement d'une quantité du broyât de chaque nodule à l'aide d'un cure-dent stérilisé, puis son ensemencement sur du milieu TY solide (BERINGER, 1974) (Annexe 3) coulé dans des boîtes de pétri et divisé en quartiers;

- les milieux ensemencés puis identifiés ont été ensuite incubés à l'étuve à 30°C ;

- Après 24 heures ou 48 heures passées à l'étuve, chaque culture bactérienne a été retirée et conservée au réfrigérateur.

Par la suite, les bactéries ont été cultivées continuellement sur des boîtes de pétri, à intervalles de temps variables, en vue de les purifier. Après trois cycles de purification à l'INP-HB, les souches ont été cultivées sur milieu TY solide, coulé en inclinaison dans des tubes Eppendorf stériles de 15 ml. Cette dernière culture a servi pour les manipulations au Laboratoire Centrale de Biotechnologie (LCB) du CNRA à Adiopodoumé.

Au LCB, les souches issues de cette dernière culture ont été cultivées une fois sur milieu TY liquide pour l'étude de la diversité, à raison de 3 ml du milieu par souche. Une réplique de cette dernière culture a été également réalisée pour une longue conservation de toutes les souches à -80°C. Les deux plaques de 96 puits chacune ont été utilisées à cet effet et chaque puits a eu comme contenu, 100 ul de suspension bactérienne + quelques gouttes de glycérol.

Cette réplique constitue l'ébauche de la collection locale des rhizobia symbiotes du C. cajan.

VII.2.2 - Préparation des cellules bactériennes par effet thermique

La PCR permettant d'amplifier à partir de petits fragments le gène ciblé sur le génome, on a effectué un choc thermique sur les bactéries afin d'avoir accès à quelques fragments d'ADNr 16S. Pour chaque bactérie, ce choc thermique a eu lieu sur 1 ml de sa suspension de 3 ml préalablement cultivée pendant 2 jours dans un incubateur-agitateur à 30°C. Les différentes étapes de ce choc thermique sont les suivantes :

- passage sur glace de chaque prélèvement bactérien (1 ml) contenu dans un tube de 1,5 ml ;

- centrifugation à 12000 t/min pendant 10 min de toutes les souches prélevées;

- recueil du culot bactérien pour chaque souche centrifugé;

- reprise du culot dans 100 ul d'eau distillée stérile et homogénéisation au vortex;

- passage sur glace des différentes souches ;

- chauffage des souches au bain-marie à 100°C pendant 10 min ;

- enfin, retour sur glace jusqu'à refroidissement total des souches.

Chaque bactérie ainsi préparée est prête pour la réalisation de la PCR-RFLP sur l'ADNr 16S.

VII.2.3 - Amplification et digestion de la région 16S de l'ADNr des rhizobia par PCR-RFLP

VII.2.3.1 - Principe de la PCR-RFLP et choix du gène de l'ADNr 16S

VII.2.3.1.1 - Principe de la PCR-RFLP

L'approche PCR-RFLP conduit à comparer la longueur des fragments de restriction d'une région choisie du génome et préalablement amplifiée par PCR, afin de déterminer le polymorphisme. Cette région est utilisée comme substrat pour les enzymes de restriction. Les enzymes de restriction sont des endonucléases qui reconnaissent spécifiquement une séquence courte (4 à 8 bases) et coupent la chaîne d'ADN chaque fois qu'elles reconnaissent cette séquence élémentaire. L'ADN se retrouve ainsi fragmenté en morceaux de différentes longueurs séparés en fonction de leur taille par électrophorèse sur un support physique. Un fragment va migrer d'autant plus loin qu'il est court. Un polymorphisme de la longueur des fragments de restriction est ainsi mis en évidence. Les profils observés permettent l'analyse de la diversité des souches par :

- la caractérisation de chaque isolat ;

- l'estimation des divergences de séquences entre isolats et l'établissement de leur proximité phylogénétique (NDOYE, 1998).

VII.2.3.1.2 - Choix du gène de l'ADNr 16S

Les gènes ribosomiques sont utilisés comme marqueurs moléculaires dans l'étude phylogénétique de différents organismes en raison de leur universalité, leur abondance, leur taille convenable aux analyses comparatives (LUDWIG et SCHLEIFER, 1999). Les ADNr contiennent par ailleurs des régions de séquences hautement conservées, très utiles pour la désignation des amorces (HILLIS et DIXON, 1991 ; STAHL et AMMAN, 1991) et d'autres régions de séquences suffisamment variables pour servir comme un excellent moyen taxonomique (GRIMONT et GRIMONT, 1986).

Chez les procaryotes particulièrement, les gènes codant pour les ARN ribosomaux sont organisés en opérons qui contiennent également des espaces intra-géniques ainsi que d'autres gènes codant pour les ARN de transfert (ARNt) (figure 13).

Figure 13 : Organisation de l'opéron de l'ADNr observé chez les procaryotes (D'après EL HILALI, 2006)

Comme le montre la figure 13, il existe trois types d'ADN ribosomique : le 5S, le 16S et le 23S (JENSEN et STRAUS, 1993). L'ADNr 5S est très peu utilisé dans les études de diversité vu sa petite taille d'environ 120 nucléotides. Contrairement à ce dernier, l'ADNr 16S codant pour la petite sous unité ribosomique d'environ 1500 pb (opéron rrs : ribosomal RNA small subunit) et l'ADNr 23S codant pour la grande sous unité d'environ 2500 à 3000 pb (opéron rrl : ribosomal RNA large subunit) (GÜRTLER et STANISICH, 1996) sont très utilisés. L'espace entre ces deux opérons est transcriptionnel d'où la désignation ITS (Internal Transcribed Spacer) (NORMAND et al., 1996). Il est aussi utilisé dans ces études. Toutefois, depuis que WOESE (1987) a montré que le gène de l'ADNr 16S est présent chez toutes les bactéries, qu'il a la même fonction et que sa structure est conservée, plusieurs chercheurs l'ont préférentiellement utilisé comme une approche rapide pour évaluer la variabilité génétique entre les souches de rhizobia (LAGUERRE et al., 1994 ; NOUR et al., 1994b).

VII.2.3.2- Réalisation de la PCR-RFLP

VII.2.3.2.1 - Principe de la PCR

La PCR (SAIKI et al., 1985 ; MULLIS et FALOONA, 1987) se réalise dans un mélange réactionnel contenant de faibles quantités d'ADN possédant la séquence à amplifier et utilisées comme matrice, des paires d'amorces nucléotidiques complémentaires des séquences qui encadrent la cible à amplifier et un ensemble de quatre dNTP (dATP, dTTP, dCTP et dGTP) nécessaires à la synthèse de nouveaux brins d'ADN. A ce mélange, s'ajoute l'enzyme de polymérisation, la Taq DNA polymérase. C'est une enzyme thermorésistante qui fut isolée à l'origine de Thermus aquaticus, une bactérie thermophile.

Classiquement, la PCR consiste en la répétition de trois étapes thermiques réalisées successivement et connu sous le nom d'étapes d'un cycle d'amplification. Chaque étape est caractérisée par un temps et une température de réalisation qui déterminent l'efficacité de toute la PCR. Dans notre cas, le cycle d'amplification se présente comme suit :

· Première étape : le double brin d'ADN est d'abord chauffé à 94°C pendant 30 secondes ; ce qui permet de rompre les liaisons entre les deux brins. C'est l'étape de dénaturation ;

· Deuxième étape : la température est abaissée à 55°C pendant 30 secondes. Au cours de cette étape les amorces s'apparient spécifiquement sur leurs séquences complémentaires aux bornes de la région à amplifier, chacune sur son brin. C'est l'étape d'amorçage ou d'hybridation, annealing. La spécificité de la PCR repose sur la qualité de cet appariement lié à la taille des amorces et à leurs séquences ;

· Troisième étape : la température est élevée à 72°C pendant 1 minute 30 secondes. A cette température, la polymérase allonge les nouveaux brins d'ADN à partir des amorces en assemblant des dNTP. On parle d'étape de polymérisation, d'extension des amorces ou d'élongation des brins d'ADN (Figure 14).

À la fin de chaque cycle d'amplification, la séquence définie par les amorces initiales est dupliquée. Les brins d'ADN néoformés ainsi que les brins initiaux servent de matrice dans les cycles successifs d'amplification. C'est la répétition des cycles de dénaturation-hybridation-élongation qui conduit finalement à une accumulation exponentielle de l'ADN, c'est-à-dire à la réalisation de la PCR. La figure 14 ci-après présente le cycle d'amplification de la PCR que nous avons réalisée au LCB du CNRA à Adiopodoumé.

VII.2.3.2.2 - Choix des amorces et milieu réactionnel de la PCR

Le tableau 4 présente la liste et les caractéristiques de la paire d'amorces utilisées.

Tableau IV : Amorces choisies pour l'amplification des fragments ADNr 16S

Amorces

Séquences 5'3'

Sites

Références

FGPS 6

GGAGAGTTAAGATCTTGGCTCA

ADNr 16S

NORMAND et al., 1992

FGPS1509

AAGGAGGGGATCCAGCCGGA

ADNr 16S

NORMAND et al., 1992

Ces deux amorces utilisées sont spécifiques de l'ADNr 16S des rhizobia. Elles furent mises au point  en 1992 (NORMAND et al., 1992) et utilisées dans plusieurs études de diversité des rhizobia basée sur cette région (NDOYE, 1998 ; SY et al., 2001 etc.).

Avec ces amorces et les autres réactifs, le milieu réactionnel de la PCR se présente comme suit (Tableau 5) :

Tableau V : Composition du milieu réactionnel unitaire commun de la PCR

 

Concentration de travail

Volume utilisé pour un échantillon

Dntp

2 ,5 Mm

2 ul

Amorce 1 (FGPS 6)

2 uM

2,5 ul

Amorce 2 (FGPS 1509)

2 uM

2,5 ul

Tampon X 10

1 X

2,5 ul

Taq DNA polymerase

-

(0,5/15) ul

Eau PCR

-

13 ul

Volume réactionnel partiel

22,5 ul

Pour réaliser la PCR, chaque tube PCR a comporté en plus de ce milieu réactionnel commun, 2,5 à 4 ul d'ADN d'une et unique souche bactérienne. Ainsi, le volume réactionnel total par souche a été de 25 ul, le volume d'eau PCR ayant été ajusté en conséquence dans chaque cas. Au total, il y a eu 169 tubes PCR à 25 ul de réactif pour autant de souches à amplifier. Pour chaque réaction d'amplification, un microtube contenant uniquement le milieu réactionnel commun a été utilisé comme témoin négatif.

VII.2.3.2.3 - Programme de la PCR

Au cours de notre PCR, le cycle d'amplification à 3 étapes a été répété 35 fois. Celui-ci définit avec 2 autres cycles (une phase de préchauffage à 94 °C pendant 5 minutes et une phase terminale de réparation des bouts des fragments à 72°C pendant 7 min), le programme total de la PCR qui dure 2 heures 7 minutes. Ce programme se présente comme suit :

Etape 1 : 94°C-------- 5 minutes

Etape 2 : 94°C-------- 30 secondes

Etape 3 : 55°C-------- 30 secondes 35 cycles

Etape 4 : 72°C-------- 1 minute 30 seconde

Etape 5 : 72°C-------- 7 minutes

A la fin de la PCR, les amplifiats peuvent être conservés dans le thermocycleur à une température de 4°C. Cette phase de conservation correspond à une étape dite de pause. Dans le cas contraire, vers la fin du temps nécessaire à la PCR (2 h 7 min), un gel d'agarose à 0,8% est préparé pour réaliser l'électrophorèse des gènes une fois l'amplification terminée.

VII.2.3.2.4 - Electrophorèse sur gel d'agarose et visualisation des gels

· Préparation du gel d'agarose

Le gel d'agarose permet de suivre la migration des fragments d'ADN en fonction de leur taille et en milieu non dénaturant. Pour le préparer, 0,8g d'agarose est pesé et mélangé à 100 ml de tampon TBE (Tris Borate EDTA) 0,5X. L'ensemble est fondu au four micro-ondes et refroidi partiellement jusqu'à environ 60°C. Le gel ainsi obtenu est coloré au BET (Bromure d'Ethydium) et coulé dans un porte gel où des peignes sont préalablement placés pour créer les puits de migration. Après solidification complète du gel, les peignes sont enlevés et ce dernier est ainsi prêt pour l'électrophorèse.

· Dépôt des amplifiats

Le gel ainsi solidifié est placé à l'intérieur d'une cuve d'électrophorèse et recouvert de tampon TBE 0,5X. Dans chaque puits, est déposé, cinq à huit microlitres (ul) d'ADN (amplifiats) préalablement mélangés avec deux microlitres de tampon de charge (bleu de bromophénol). Parallèlement, 3 ul d'un marqueur de poids moléculaire 1Kb (100 pb à 12000 bp) est déposé sur le gel, entre 1 et 2 puits, pour vérifier la taille attendue de l'ADNr 16S amplifié. Enfin, l'allumage de l'appareil d'électrophorèse de type Mupid-One permet de mettre en migration pendant 30 minutes et à 100 V, les amplifiats déposés sur le gel.

VII.2.3.2.5 - Migration de l'ADN et visualisation

Après le temps de migration fixé, le gel est retiré de la cuve d'électrophorèse, puis déposé sur une plaque de lumière ultraviolette pour la visualisation. Sur cette plaque, la visualisation des amplifiats est rendue possible grâce au BET. En effet, celui-ci, en tant que cation, s'intercale entre les brins de l'ADN et rend ainsi le complexe ion éthidium-ADN fluoresçant sous l'éclairage UV. La prise d'images est effectuée à l'aide du transilluminateur à caméra relié à un ordinateur.

Après cette visualisation et les prises d'images, les souches dont le gène ADNr 16S a été correctement amplifié sont sélectionnées en vue de leur digestion.

VII.2.3.2.6 - Digestion des amplifiats

La digestion enzymatique du produit de la PCR a été réalisée sur les souches bien amplifiées. L'enzyme de restriction utilisée est la Tsp 509I (R0576S). Ses caractéristiques sont données dans le tableau 6 ci après.

Tableau VI : Caractéristiques de l'enzyme de restriction Tsp 509I

Enzyme de restriction

Sites à 4 paires de bases

Tsp 509I (R0576S)

5'...A A T T...3'

3'...T T A A...5'

Cette enzyme a été déjà utilisée pour digérer des amplifiats du gène ADNr 16S dans des études de diversité.

Le milieu réactionnel de la digestion se présente comme suit (Tableau 7) :

Tableau VII : Composition du milieu réactionnel unitaire commun de la digestion

 

Concentration de travail

Volume utilisé pour un échantillon

Tampon X 10

1 X

1,5 ul

Enzyme de digestion Tsp 509I

-

(2/10) ul

Eau PCR

-

3,5 ul

Volume réactionnel partiel

5 ul

Pour réaliser la digestion, chaque tube a comporté en plus de ce milieu réactionnel commun, 10 à 15 ul d'amplifiat d'une et unique souche bactérienne. Ainsi, le volume réactionnel total par souche varie entre 15 et 20 ul.

La digestion a eu lieu pendant 3 à 4 heures dans un bain marie chauffé à 65°C. Un témoin négatif constitué uniquement de 15 ul d'un bon amplifiat a accompagné chaque digestion.

À la fin de la digestion, la migration et la visualisation des fragments de restriction obtenus ont été effectuées dans les mêmes conditions que celles des produits PCR. Cependant, la petite taille des fragments de restriction générés a nécessité la préparation d'un gel d'agarose plus résolutif (agarose à 3%) et un temps de migration de 50 min. Aussi, note-on qu'ici, tout le produit de digestion de chaque souche (10 à 15 ul) a été entièrement mis en migration contrairement aux amplifiats.

CHAPITRE VIII : RESULTATS ET DISCUSSION

 

VIII.1- RESULTATS

Ces résultats concerneront d'une part le comportement des bactéries observé sur le milieu de culture TY pendant leur purification et d'autre part le polymorphisme des fragments de restriction de l'ADNr 16S amplifié de ces isolats.

VIII.1.1- Croissance des bactéries sur milieu TY solide

La culture des bactéries isolées des nodules du pois cajan sur milieu TY solide en vue de leur purification a permis de les subdiviser en deux groupes selon le temps d'apparition des colonies. Le premier groupe, noté bactéries à croissance rapide ou XR, (65, 1 % des isolats) développe des colonies denses et bien identifiables en 24 heures d'incubation tandis qu'il faut un temps de 48 heures au deuxième groupe (bactéries à croissance lente ou XL) pour développer des colonies ayant les mêmes aspects (figure 15). Ce résultat a été observé pendant quatre cycles de purification des isolats sur le milieu TY.

: Niveau de croissance des deux groupes de B : Niveau de croissance des deux groupes de

bactéries 24 h après ensemencement bactéries 48 h après ensemencement

XR

XR

XL

XL

Figure 15 : Mode de croissance sur milieu TY en 24 heures et 48 heures des groupes de rhizobia isolés du pois cajan

VIII.1.2 Amplification par PCR de l'ADNr 16S

La PCR réalisée sur l'ADNr 16S de toutes les bactéries isolées pour l'étude (169) a permis d'en amplifier 152, soit un taux d'amplification de 88,4 %. Cette amplification a généré une bande unique révélée par électrophorèse chez l'ensemble de ces 152 souches. Evaluée visuellement par comparaison au marqueur utilisé, la taille de la bande correspond au poids moléculaire de 1500 pb (figure 16).

M B27.1 B40.3 B35.1 B20.3 B14.4 B39.2 B14.2 B28.2 B23.1 T-

1500 pb

Figure 16 : Résultats d`amplification de l'ADNr 16S des rhizobia isolés de Cajanus cajan

M : Marqueur de poids moléculaire 1kb ; T- : Témoin négatif (Milieu PCR sans ADN)

B27.1: Code d'identification (ici, souche n°1 des quatre cultivées sur la boîte de pétri n° 27).

VIII.1.3 Produits de digestion

La digestion effectuée sur toutes les souches amplifiées avec l'enzyme de restriction Tsp 509I a généré trois profils différents en se basant sur le nombre de bandes de digestion généré par souche. Il s'agit d'un profil à deux bandes (A), d'un profil à trois bandes (B) et d'un dernier profil à quatre bandes (C) (Figure 17).

M B A A B B B B B B B B T-

M C C C C C C C T-

Gel N°2

Gel N°1

Figure 17 : Différents profils de digestion obtenus avec l'enzyme de restriction Tsp 509I.

M : Marqueur de poids moléculaire 1kb ; T- : Témoin négatif (Amplifiat sans Tsp 509I) ; 

A : Profil à deux (2) bandes ; B : profil à trois (3) bandes ; C : Profil à quatre (4) bandes.

La proportion relative de chaque profil est donnée par la figure 18:

Figure 18 : Proportions relatives des trois profils obtenus par PCR-RFLP

La figure 18 montre une abondance relative du profil de digestion à 3 bandes (53,9 %). Le profil à 2 bandes est le moins important et représente 11,2 % de l'ensemble des souches digérées.

Une analyse des profils de digestion en rapport avec la vitesse de croissance des souches a donné les résultats présentés par la figure 19:

Figure 19 : Proportions des profils de digestion des souches supposées à croissance lente

Cette figure fait ressortir la présence des trois types de profils observés chez les

bactéries supposées à croissance lente. Toutefois, une proportion plus faible (3,4 %) pour le

profil à deux bandes est à souligner. Ces observations sont complémentaires à celles faites avec les souches supposées à croissance rapide. Ainsi, l'analyse des profils de digestion en rapport avec la vitesse de croissance des souches n'a établi aucun lien particulier entre l'un ou l'autre des groupes de croissance et les types de profils.

Tous les résultats ci-dessus obtenus feront l'objet d'une discussion dans le paragraphe suivant.

VIII.2- DISCUSSION DES RESULTATS

La différence de temps de croissance observée entre les isolats symbiotiques du pois d'Angole, pendant les cycles de culture et de purification sur milieu TY solide, pourrait être rapprochée des résultats obtenus en cultivant les rhizobia sur milieu YMA (Yeast Manitol Agar) (VINCENT, 1970). En effet, les rhizobia se subdivisent en deux groupes lorsqu'ils sont cultivés sur le milieu de culture YMA. Ce milieu est celui utilisé pour l'évaluation de la vitesse de croissance des bactéries à travers la détermination de leur temps de génération ainsi que le temps nécessaire pour le développement de colonies complètes. En l'utilisant, JORDAN (1982) a pu établir la première classification des bactéries symbiotiques fixatrices d'azote en deux genres (genres Rhizobium et Bradyrhizobium). Le premier genre représente le groupe des bactéries possédant un temps d'apparition de colonies complètes inférieur ou égal à cinq jours d'incubation et dites bactéries ``à croissance rapide''. Quant au second, il représente les bactéries dites `` à croissance lente '', caractérisées par le développement de colonies complètes entre cinq et sept jours d'incubation.

Par ailleurs, en prenant pour critère leur vitesse de croissance sur le milieu de culture YMA, SY et al. (2000) ont pu répartir une collection de 126 souches de rhizobia isolées du Crotalaria spp. en 2 groupes distincts. Un premier groupe de 81 souches à croissance rapide, dont les colonies apparaissent après 48 h de culture, et un second groupe de 45 souches à croissance lente pour lesquelles les colonies n'apparaissent qu'au bout de 72 h de culture.

Nos résultats sont quasi-identiques à ce résultat obtenu au Sénégal et révèlent de ce fait, une diversité physiologique au sein des bactéries étudiées. Le milieu TY pourrait donc être utilisé pour évaluer la diversité physiologique des rhizobia en fonction de leur vitesse de croissance.

Le taux d'amplification de 88,4 % de l'ADNr 16S des isolats cultivés sur ce milieu est un résultat satisfaisant, tenant compte du protocole utilisé pour obtenir les fragments d'ADN à amplifier. En effet, si ce protocole (Préparation des bactéries par effet thermique) a l'avantage d'être très rapide comparativement au protocole d'extraction de l'ADN, il ne permet pas par contre d'éliminer totalement certains inhibiteurs susceptibles d'influencer les résultats de la PCR (protéines, etc.). Ainsi, un calibrage de l'ADN dans le milieu réactionnel de la PCR, tenant compte de ces inhibiteurs, pourrait améliorer le résultat. Par ailleurs, une variation du volume d'ADN de 2,5 à 4 ul selon les souches a été nécessaire pour avoir nos résultats.

La taille des amplifiats obtenus (1500 pb) est bien celle attendue de 1'ADNr 16S parmi les bactéries (WEISBURG et al., 1991). Ce résultat est aussi identique à celui obtenu par DUBEY et al. (2010), en amplifiant cette même région chez des rhizobia isolés également du pois d'Angole en Inde. Le nombre de profils obtenus après digestion des amplifiats (3) met en évidence une diversité génétique au sein des bactéries symbiotes du pois cajan en Côte d'Ivoire. Ce résultat confirme l'importance de l'ADNr 16S dans l'évaluation de la diversité des bactéries en général et des rhizobia en particulier. En effet, grâce à sa structure très conservée mise en évidence par WOESE (1987), l'étude du gène de l'ARNr 16S constitue une excellente approche rapide pour évaluer la variabilité génétique entre les souches de rhizobia (LAGUERRE et al., 1994; NOUR et al., 1994b; SYLLA ,1998; NDOYE, 1999). Par ailleurs, la diversité observée est aussi comparable à celle obtenue en 2010 par DUBEY et ses collègues en Inde. En effet, utilisant trois enzymes de restriction différentes (contre une dans notre cas), leur étude a pu établir une diversité au sein des symbiotes du pois cajan dans le District de Betul. Les profils variaient d'un à quatre selon l'enzyme utilisée et quant au nombre de bandes de digestion généré par profil, il s'est situé entre deux et trois.

Enfin, l'inégalité constatée entre les fréquences des trois groupes génétiques constitués par l'étude peut s'expliquer d'une part par une capacité compétitive non identique de ces groupes au cours du processus de nodulation (ZEZE et al., 2001). En effet, les différentes souches de rhizobia coexistant simultanément dans un sol présentent des différences de capacité à rivaliser pour la formation des nodules (POSTMA et al., 1989 ; HEIJNEN et VAN VEEN, 1991). Ainsi, les deux groupes génétiques les plus représentés au sein de la population rhizobienne étudiée pourraient être ceux des souches symbiotiques les plus performantes dans la nodulation du champ de pois d'Angole étudié, notamment en termes d'infectivité. D'autre part, ces résultats peuvent s'expliquer par une densité de population saprophytique inégale entre les différentes souches rhizobiennes présentes dans la rhizosphère du pois d'Angole. En effet, certaines souches maintiennent dans le sol une faible densité de population en absence de la légumineuse hôte (HIRSCH, 1996 ; ZEZE et al., 2001), alors que le succès de celles-ci dans la symbiose est aussi influencé par cette taille initiale (POSTMA et al., 1989 ; HEIJNEN et VAN VEEN, 1991). Les souches ayant une plus forte densité de population initiale ont naturellement plus de candidats potentiels à la nodulation et leur abondance au sein de la population symbiotique peut par conséquent être plus élevée.

CONCLUSION ET PERSPECTIVES

 

Notre étude qui s'inscrit dans le cadre de l'amélioration de la productivité des légumineuses par l'optimisation de la fixation azotée, a consisté à initier l'évaluation de la diversité des rhizobia nodulant le pois cajan en Côte d'Ivoire. L'objectif principal était de déterminer le niveau de variabilité génétique entre des souches rhizobiennes isolées d'un champ de ce pois cultivé à Yamoussoukro. Cette diversité a été évaluée par l'amplification de l'ADNr 16S des rhizobia suivie d'une digestion des amplifiats par une enzyme de restriction.

Au terme de cette étude, on retiendra que :

- les souches isolées présentent une diversité physiologique sur le milieu de culture TY. Deux groupes ont été identifiés avec une domination des souches développant des colonies denses et bien identifiables en 24 heures d'incubation ;

- le nombre de profils (trois) obtenus après digestion des souches amplifiées met en évidence une diversité génétique au sein des bactéries symbiotes du pois cajan ;

- une hétérogénéité dans les fréquences relatives des trois types de profils a été aussi observée.

Ces résultats nous donnent une grande satisfaction et permettent d'affirmer que nos objectifs ont été atteints. Toutefois, au delà de la variabilité génétique révélée, la PCR-RFLP de l'ADNr 16S ne permet pas une connaissance taxonomique de ces isolats symbiotiques. Ainsi, le recourt à des techniques plus avancées comme le séquençage de l'ADNr 16S des souches est nécessaire pour révéler l'identité des groupes constitués par le polymorphisme de la longueur des fragments de restriction. Par ailleurs, cette approche moléculaire (séquençage) est souvent utilisée comme une méthode complémentaire à la PCR-RFLP dans les études de diversité des rhizobia. Le couplage des deux techniques permet en effet d'établir des liens phylogénétiques entre les isolats d'une part et d'autre part entre les isolats et des souches de références déjà identifiées comme symbiotes de la légumineuse étudiée (NDOYE, 1998 ; SYLLA, 1998).

Le renforcement de notre collection initiale des souches symbiotiques, à travers une étude multilocale, s'avère également nécessaire pour avoir une vision globale de la diversité des populations locales de rhizobia symbiotes du pois d'Angole. Enfin, l'évaluation des caractéristiques symbiotiques des isolats (infectivité, efficience, aptitude à la compétition etc.) serait à considérer dans ces études. Cette évaluation apparaît en effet très déterminante dans tout processus d'exploitation de la fixation biologique de l'azote à des fins pratiques.

REFERENCES BIBLIOGRAPHIQUES

 

ABAIDOO R.C., KEYSER H.H., SINGLETON P.W. & BORTHAKUR D., 2000. Bradyrhizobium spp. (TGx) isolates nodulating the new soybean cultivars in Africa are diverse and distinct from bradyrhizobia that nodulate North American soybeans. International Journal of Systematic and Evolutionary Microbiology, 50, 225-234.

AHMAD M.H., EAGLESHAM A.R.J. & HASSOUNA S., 1981 b. Examining serological diversity of cowpea rhizobia by the ELISA technique. Arch. Microbiol., 130, 281-287.

AHMAD M.H., EAGLESHAM A.R.J., HASSOUNA S., SEAMAN B., AYANABA A., MULONGOY K. & PULVER E.L., 1981 a. Examining the potential for inoculant use of cowpeas in West Africans soils. Tropic. Agron. (Trin), 58, 325-335.

ALLEN O.N. & ALLEN E.K., 1950. Biochemical and Symbiotic Properties of the Rhizobia. Bacterial. Rev., 14, 273-330.

ANONYME, 2002. Mémento de l'Agronome [CD-ROM]. (2002). France : Ministère de la coopération et du Développement Paris.

ANONYME., 2008. La plaquette de présentation du CNRA, 16 p.

ANONYME, 2009. Ecole Supérieure d'Agronomie, Départements et sections affiliés, 16 p.

ANONYME. Flavonoids Induce Nodulation, 2010, (page consultée le 24 Avril 2010) < http://www.microbiologyprocedure.com/rhizobium-and-legume-root-nodulation/flavonoids-induce-nodualation.html >.

AVO N.J.D., 2010. Contribution à l'optimisation de la détection du virus du Swollen Shoot (CSSV) dans les feuilles de cacaoyer en Côte d'Ivoire. Mémoire de fin d'études pour l'obtention du diplôme d'Agronomie Approfondie. Ecole Supérieure d'Agronomie, Yamoussoukro, 50 p.

BALDWIN I. L. & FRED E. B., 1929. Nomenclature of the root nodule bacteria of the leguminosae. J. Bacteriol., 17, 141-150.

BARRIOS E., KWESIGA F., BURESH R.J. & SPRENT J.I., 1997. Light fraction soil organic matter and available nitrogen following trees and maize. Soil Sci. Soc. Am. J., 61, 826-831.

BARTHOUX, Jean Claude. La famille des Fabacées ou Légumineuses, 1975, (page consultée le 15 novembre 2009) < http://www.sologne-nature.org/content/view/158/10/>.

BASHIR J., BURESH R.J. & PLACE F.M. 1998. Sesbania tree fallows on phosphorus-deficient sites: Maize yield and financial benefit. Agron. J., 90, 717-726.

BECK D.P., MATERON L.A., AFANDI F., 1993. Pratical Rhizobium-Legume Technology Manual. ICARDA, Allepo, Syria, 170 p.

BENDER G.L., PLAZINSKI J. & ROLFE B.G., 1986. A symbiotic acetylene reduction by a fast-growing cowpea Rhizobium strain with nitrogen structural genes located on a symbiotic plasmid. Environ. Microbiol., 51, 868-871.

BENTHAM G., 1865. Leguminosae. In Genera Plantarum. Bentham G. and Hooker J. D. eds., Lovell, Reeve, London, pp. 434-600.

BERINGER J.E., 1974. R factor transfer in Rhizobium leguminosarum. J. Genet. Microbiol., 84, 188-198.

BHAGWAT A.A., GROSS K.C., TULLY R.E. & KEISTER D., 1996. Glucan synthesis in Bradyrhizobium japonicum: characterization of a new locus (ndvC) influencing â -(1 6) linkages. J. Bacteriol., 178, 4635-4642.

BOEHRINGER A., & CADWEL R., 1989. Cajanus cajan (L.) Millsp. as potentiel agroforestry component in the Eastern Province of Zambia. Agroforestry systems, 9, 127-140.

BORGET M., 1989. Pois cajan (Cajanus cajan (L.) Millsp). In Les légumineuses vivrières tropicales. Maisonneuve et Larose, eds., A.C.C.T., Paris, P. 29.

BREEDVELD M. W. & MILLER K. J., 1998. Cell-surface â-glucans. In The Rhizobiaceae. Spaink H.P., Kondorosi A., Hooykaas J. J., eds., Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 81-96.

BREWIN N.J., DOWNIE J.A. & YOUNG J.P.W., 1992. Nodule formation legumes. Encyclopedia of microbiology, M.R Josha Lederberg. Rockefeller University New York, 3, 239-248.

BROUGHTON W. J., JABBOURI S. & PERRET X., 2000. Keys to symbiotic harmony. J. Bacteriol., 182, 5641-5652.

CERVANTES E., SHARMA S.B., MAILLET F., VASSE J., TRUCHET G. & ROSENBERG C., 1989. The Rhizobium meliloti host range nod O genes encodes a proteine which shares homology with translation elongation and initiations factors. M. Microbiol., 3, 745-755.

CHEN W. X., YAN G. H. & LI J. L., 1988. Numerical taxonomic study of fast-growing soybean rhizobia and a proposal that Rhizobium fredii be assigned by Sinorhizobium gen. nov. Int. J. Syst. Evol. Microbiol., 38, 392-397.

CHEN W.M., JAMES E.K., PRESCOTT A.R., KIERANS M. & SPRENT J.I., 2003. Nodulation of Mimosa spp. by the beta-proteobacterium Ralstonia taiwanensis. Mol Plant Microbe Interact, 16, 1051-1061.

CRONK Q., OJEDA I. & PENNINGTON R.T., 2006. Legume comparative genomics: progress in phylogenetics and phylogenomics. Curr Opin Plant Biol, 9, 99-103.

CRUTZEN P.J., MOSIER A.R., SMITH K.A. & WINIWARTER W., 2007. N2O release from agro-biofuel production negates global warming reduction by replacing fossil fuels. Atmos. Chem. Phys. Discuss. 7, 11191-11205.

DAVET P., 1996. Vie microbienne du sol et production végétale. Institut National de la Recherche Agronomique. INRA, Paris, 384 p.

DAY D.A., POOLE P.S., TYERMAN S.D. & ROSENDAHL L., 2001. Ammonia and amino acid transport across symbiotic membranes in nitrogen-fixing legume nodules. Cell Mol Life Sci, 58, 61-71.

DEBELLE F. & SHARMA S.B., 1986. Nucleotide sequence of Rhizobium meliloti RCR 2011 genes involved in host specificity of nodulation. Nucl. Acids Res. H., 14, 7453-7472.

DEBELLE F., MOULIN L., MANGIN B., DENARIE J. & BOIVIN C., 2001. Nod Genes and Nod signals and the evolution of the rhizobium legume symbiosis. Acta Biochimia Polonia Minireview, 48 (2), 359-365.

DEBELLE F., ROSENBERG C., VASSE J., MAILLET F., MARTINEZ E., DENARIE J. & TRUCHET G., 1986. Assignment of symbiotic developmental phenotypes to cornmon and specifie nodulation (nod) genetic loci of Rhizobium meliloti. J. Bacteriol., l68, 1075- 1086.

DUBEY R.C., MAHESHWARI D.K., KUMAR H. & CHOURE K., 2010. Assessment of diversity and plant growth promoting attributes of rhizobia isolated from Cajanus cajan L. African Journal of Biotechnology, 9(50), 8619-8629.

DUHOUX M. & NICOLE M., 2004. Biologie Végétale. Associations et Interactions chez les plantes. Dunod-IRD, Paris, 176 p.

DUKE J.A., 1981a. Manuel de légumineuses du monde économique. Plenum Press, New York, pp. 33-37.

EL HILALI I., 2006. La symbiose rhizobium-lupin : biodiversité des microsymbiotes et mise en évidence d'une multi-infection nodulaire chez Lupinus luteus. Thèse de doctorat. Université Mohammed V-AGDAL, Rabat, 189 p.

FAOSTAT. (Page consultée en août 2007) <http://faostat.fao.org/faostat /collections?

Version=ext&hasbulk=0&subset=agriculture>.

FRED E. B., BALDWIN I. L. & MCCOY E., 1932. Root nodule bacteria and leguminous plants. University of Wisconsin Press, Madison, Wis. (in: Elkan, 1902).

FREIBERG C., FELLAY R., BAIROCH A., BROUGHTON W.J., ROSENTHAL A. & PERRET X., 1997. Molecular basis of symbiosis between Rhizobium and legumes. Nature, 387, 394-401.

GAGE D.J., 2004. Infection and invasion of roots by symbiotic, nitrogen-fixing rhizobia during nodulation of temperate legumes. Microbiol Mol Biol.Rev., 68 (2), 280-300.

GEURTS R. & BISSELING T., 2002. Rhizobium Nod factor perception and signaling. Plant Cell, 14, 239-249.

GILLIS M., VANDAMME P., DE VOS P., SWINGS J.Y. & KERSTERS K., 2001. Polyphasic taxonomy. Pp. 43-48. In Bergey's Manual of Systematic Bacteriology, 2nd Edition, Volume I. Boone, D.R., R. W. Castenholz, G. M. Garrity (eds.).

GONZALEZ J.E., REUHS B. L. & WALKER G.C., 1996. Low molecular weight EPS II of Rhizobium meliloti allows nodule invasion in Medicago sativa. Proc. Natl. Acad. Sci. USA, 93, 8636-8641.

GRAHAM P.H., 1991. What are Rhizobia?. The College of Agricultural Food and Environment Science.

GRAHAM P.H. & VANCE C.P., 2003. Legumes: importance and constraints to greater use. Plant Physiol, 131, 872-877.

GRAHAM P.H., SADOWSKY M.J., KERSTERS H. H., BARNET Y.M., BRADLEY R.S., COOPER J.E., DE LEY D.J., JARVIS B.D.W., ROSLYCKY E.B., STRIJDOM B.W. & YOUNG J.P.W., 1991. Proposed minimal standards for the description of new genera and species of root-and stem-nodulating bacteria. Int. J. Syst. Bacteriol., 41, 582-587.

GRIMAUD P., 1988. Revue d'Elevage et de Médecine Vétérinaire de Nouvelle-Calédonie (11), pp29-36.

GRIMONT F. & GRIMONT P.A.D., 1986. Ribosomal ribonucleic acid gene restriction patterns as potential taxonomic tools. An. Inst. Pasteur Microbiol., 137B, 165-175.

GÜRTLER V. & STANISICH V. A., 1996. New approaches to typing and identification of bacteria using the 16S-23S rDNA spacer region. Microbiology, 142, 3-16.

HAUKKA K., LINDSTROM K. & YOUNG P.W., 1998. Three Phylogenetic Groups of nodA and nifH Genes in Sinorhizobium and Mesorhizobium Isolates from Leguminous Trees Growing in Africa and Latin America. Appl Environ Microbiol.Rev., 64 (2), 419-426.

HEIJNEN C. E., VAN VEEN J.A., 1991: A determination of protective microhabitats for bacteria introduced into soil. FEMS Microbiol. Ecol., 85, 73-80.

HILLIS D.M. & DIXON M.T., 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. Q. Rev. Biol. 66, 411-453.

HIRSCH P.R., 1996. Population dynamics of indigenous and genetically modified rhizobia in the field. New phyt. 133, 159-171.

HOPKINS W.G., 2003. Physiologie végétale. Université des Sciences et Technologie de Lille. Edition de boeck, 514 p.

HORVATH B., KONDORASI E., JOHNSON M., SCHMIDT J., TOROK L., GYORGYPAL Z., BARABAS L., WIENEKE V., SCHELL J. & KONDOROSI A., 1986. Organization structure and syrnbiotic function of Rhizobium meliloti nodulation genes determining host specilicity for alfalfa. Cell, 46, 335-343.

HULUGALLE R. N. & LAL R., 1986. Root growth of maize in compacted gravely tropical alfisoil as affected by rotation with a woody perennial. Field Crop Research, 13, 33-44.

JAFTHA J.B., STRIJDOM B.W. & STEYN P.L., 2002. Characterization of pigmented methylotrophic bacteria which nodulate Lotononis bainesii. Syst Appl Microbiol, 25, 440-449.

JENSEN M. A. & STRAUS N., 1993. Effect of PCR conditions on the formation of heteroduplex and single-stranded DNA products in the amplification of bacterial ribosomal DNA spacer regions. PCR Methods Appl., 3, 186-194.

JORDAN D.C., 1982. Transfer of rhizobium japonicum Buchanan 1980 to Bradyrhizobium gen. nov., a genus of slow growing root nodule bacteria from leguminous plants, Int. J. Syst. Bacteriol., 32, 136-139.

JORDAN D.C., 1984. Rhizobiaceae. In Bergey's Manual of Systematic Bacteriology. Krieg N. R. et Holt J. G. eds., Baltimore, pp. 234-245.

KANNAIYAN J., NENE Y.L., REDDY M.V., RYAN J.G., & RAJU T.N., 1984. Prevalence of pigeonpea diseases and associated crop losses in Asia, Africa, and America. Trop. Pest Manag., 30, 62-71.

KNEIP C., LOCKHART P., VOSS C. & MAIER U.G., 2007. Nitrogen fixation in eukaryotes -new models for symbiosis. BMC Evol Biol, 7, 55.

KUMAR RAO I.V.D.K., THOMPSON J.A., SASTRY P.U.S.S., GILLER K.E. & DAY J.M., 1986. Measurement of N2 fixation in field grown pigeonpea using 15N-labelled fertilizer. Plant Soil, 101, 102-113.

LAFAY B., BULLIER E. & BURDON J.J., 2006. Bradyrhizobia isolated from root nodules of Parasponia (Ulmaceae) do not constitute a separate coherent lineage. Int J Syst Evol Microbiol, 56, 1013-1018.

LAGARES A., CAETANO-ANOLLES G., NIEHAUSS K., LORENZEN J., LJUNGGREN H.D. & FAVELUKES G., 1992. A Rhizobium meliloti lipopolysaccharide mutant altered in competitiveness for nodulation of alfalfa. J. Bacteriol., 174, 5941-5952.

LAGUERRE G., ALLARD M.R., REVOY F. & AMARGER N., 1994. Rapid identification of rhizobia by restriction fragment length polymorphism analysis of PCR- amplified 16S rRNA genes. Appl. Environ. Microbiol., 60, 56-63.

LANCELLE S.A. & TORREY J.G., 1985. Early development of Rhizobium-induced root nodules of Parasponia rigida. II Nodule morphogenesis and symbiotic development. Can J Bot, 63, 25-35.

LEPAPE M.C., 1980. Aperçu sur les fourrages ligneux des îles du Cap-Vert. In `` Les fourrages ligneux en Afrique. Etat actuel des connaissances''. (Le Houerou, ed.)., CIPEA, Addis Abeba, pp. 123-125.

LOHNIS F. & HANSEN R., 1921. Nodule bacteria of leguminous plants. J. Agr. Res., 20, 543-546.

LUDWIG W. & SCHLEIFER K. H., 1999. Phylogeny of bacteria beyond the 16S RNA Standard. ASM News., 65, 752-757.

MACCOLL D., 1989. Studies on maize (Zea mays L) at Bunda, Malawi. II. Yield in short rotation with emphasis on phosphorus. Soil Sci., 152, 315-320.

MERCADO-BLANCO J. & TORO N., 1996. Plasmids in rhizobia: The role of nonsymbiotic plasmids. MPMI., 9, 535-545.

MINJA E.M., 2001. Yield losses due to field pests and integrated pest management strategies for pigeonpea a synthesis: In, Silim SN, Mergeai G, Kimani PM (ed). Status and potential of pigeonpea in East and southern Africa : Proceedings of a regional workshop, 12-15 Sep, 2000, Nairobi, Kenya. B-5030 Gembloux, Belgium: Gembloux Agricultural University, and Pantecheru, Andhra Pradesh, India: International Crops Research Institute for the semi-Arid Tropics.

MOULIN L., MUNIVE A., DREYFUS B. & BOIVIN-MASSON C., 2001. Nodulation of legumes by members of the ß-subclass of Proteobacteria. Nature, 411, 948-950.

MULLIS K.B. & FALOONA F.A., 1987. Specific synthesis of DNA in vitro via a polymerase catalysed chain reaction. Methods Enzymol., 155, 335-350.

NADIMPALLI B.G., JARRET R.L., PATHAK S.C. & KOCHERT G., 1992. Phylogenetic relationships of pigeonpea (Cajanus cajan ) based on nuclear restriction fragment length polymorphisms. Genome, 36, 216-223.

NDABALISHE I., 1995. Agriculture vivrière ouest africaine à travers le cas de la Côte d'Ivoire. Monographie. IDESSA, 383 p.

NDOYE I., 1998. Etude taxonomique et caractérisation des bactéries fixatrices nodulant les Caesalpinioideae de la sous-Famille des Cassieae (Cassia, Chamaecrista et Senna). Rapport de stage séjour scientifique haut niveau. Laboratoire des Symbioses Tropicales et Méditerranéennes (LSTM), Montpellier, 32 p.

NDOYE I., 1999. Caractérisation taxonomique des bactéries fixatrices d'azote nodulant Acacia nilotica var. andansonii et var. tomentosa (Mimosoideae, sous famille des Acacieae). Rapport de stage séjour scientifique haut niveau. Laboratoire des Symbioses Tropicales et Méditerranéennes (LSTM), Montpellier, 35 p.

NENE Y.L. & SHEILA V.K., 1990. Pigeonpea: geography and importance. In The Pigeonpea. Nene Y.L., Hall S.D. and Sheila V.K. eds., CAB International, UK, pp. 1-14.

NIYONKURU D. N., 2002. La culture du pois cajan. SAILD, Cameroun, 23 p.

NOEL K.D., 2009. Bacteria Rhizobia. Encyclopedia of microbiology, SCHAECHTER M. San Diego. Marquette University, Milwaukee, WI, USA, 3, 877-893.

NORMAND P., COURNOYER B., NAZARET S. & SIMONET P., 1992. Analysis of a ribosomal RNA operon in the actinomycete Frankia. Gene , 3, 119-124.

NORMAND P., PONSOET C., NESME X., NEYRA M. & SIMONET P., 1996. ITS analysis of prokaryotes. Mol. Microbial. Ecol. Manual., 3, 1-12.

NOUR S.M., CLEYET-MAREL J. C., BECK D., EFFOSE A. & FERNANDEZ M. P., 1994b. Genotypic and phenotypic diversity of Rhizobium isolated from chickpea (Cicer arietinum L.). Can J. Microbiol., 44, 345-354.

NUTMAN P.S., 1981. Hereditary host factors affecting nodulation and nitrogen fixation. In Current Perspectives in Nitrogen Fixation Gibson. A.H. and Newton W.E. (eds). Elsevier, North Holland, pp. 194- 204.

OLSEN G., WOESE J. C. & OVERBEEK R., 1994. The winds of (evolutionary) change: breathing new life into microbiology. J. Bacteriol., 176, 1-6.

OTT T., VAN DONGEN J.T., GUNTHER C., KRUSELL L., DESBROSSES G., VIGEOLAS H., BOCK V., CZECHOWSKI T., GEIGENBERGER P. & UDVARDI M.K., 2005. Symbiotic leghemoglobins are crucial for nitrogen fixation in legume root nodules but not for general plant growth and development. Curr Biol, 15, 531-535.

PELMONT J., 1995. Bactérie et environnement : adaptation physiologique. Vol 2. Office des Publications Universitaires, 897 p.

PEOPLES M.B., HERRIDGE D.F., LADHA J.K., 1995. Biological nitrogen fixation : An efficient source of Nitrogen for sustainable agricultural production? Plant and Soil, 174, 3-28.

PERRET X., STAEHELIN C. & BROUGHTON W.J., 2000. Molecular basis of symbiotic promiscuity. Microbiol Mol Biol, 64, 180-201.

PETERS N.K. & VERMA D.P.S., 1990. Phenolic compounds as regulators of gene expression in plant-microbe interactions. Mol. Plant Microbe Interac., 3, 4-8.

PFEFFER P.E., BECARD G., ROLIN D.B., UKNALIS J., COOK P. & TU S., 1994. In vivo nuclear magnetic resonance study of the osmoregulation of phosphocholine-substituted â-1,3;1,6 cyclic glucan and its associated carbon metabolism in Bradyrhizobium japonicum USDA 110. Appl. Environ. Microbiol., 60, 2137-2146.

POSTMA J., WALTER S., VAN VEEN J.A., 1989: Influence of different initial moisture contents on the distribution and population dynamics of introduced Rhizobium leguminosarum biovar trifolii. Soil Biol. Biochem., 21,437- 442.

PRIN Y., GALIANA A., DUCOUSSO M., DUPUY N., DE LAJUDIE P. & NEYRA M., 1993. Les Rhizobiums d'Acacia : Biodiversité et taxonomie. Bois et Forêts des Tropiques, 238, 5-20.

PUEPPKE S.G. & BROUGHTON W. J., 1999. Rhizobium sp. NGR234 and R. fredii USDA257 share exceptionally broad, nested host-ranges. Mol. Plant-Microbe Interact., 12, 293-318.

RAMSUBHAG A., UMAHARAN P. & DONAWA A., 2002. Partial 16S rRNA gene sequence diversity and numerical taxonomy of slow growing pigeonpea (Cajanus cajan L. Millsp) nodulating rhizobia. FEMS Microbiology Letters, 216, 139-144.

RIVAS R., VELÁZQUEZ E., WILLEMS A., VIZCAÍNO N., SUBBA-RAO N. S., MATEOS P. F., GILLIS M., DAZZO F. B. & MARTÍNEZ-MOLINA E., 2002. A New species of Devosia that forms a unique Nitrogen-fixing root-nodule symbiosis with the aquatic legume Neptunia natans (L.f.) Druce. Appl. Environ. Microbiol., 68, 5217-5222.

ROGER P., DOMMERGUES Y., BALANDREAU J., DREYFUS B. & SOUGOUFARA B., 1996. Résumé et introduction. In : ROGER P., DOMMERGUES Y., BALANDREAU J., DREYFUS B. & SOUGOUFARA B., eds. La fixation biologique de l'azote: quelles potentialités pour le développement ? Compte rendu de conférence-débat de l'ORSTOM, 30 Mai, 1996, Paris. 2-7.

SAIKI R.K., SCHARF S., FALOONA F., MULLIS K.B., HOM G.T., EDITH H.A. & ARUHEIN N., 1985. Enzymatic amplification of betaglobin genomic sequences and restriction site analysis for diagnostic of sickle cell anemia. Science, 230, 1350-1354.

SAWADA H., KUYKENDALL L.D. & YOUNG J.M., 2003. Changing concepts in the systematics of bacterial nitrogen-fixing legume symbionts. J. Gen. Appl. Microbiol., 49, 155-179.

SEDGA Z., 1997. Gestion améliorée de la jachère par l'utilisation des légumineuses de couverture. In La jachère, lieu de production. Floret C. eds., CORAF/IRD ex ORSTOM/UE, Dakar, pp.133-139.

SHARMA P.K., KUNDU B.S. & DOGRA R.C., 1993. Molecular mechanism of host specificity in legume-rhizobium symbiosis. Biotech. Adv., 11, 741-779.

SIAMBI M., OMANGA P.G.A., SONGA W., 1992. Status and needs of the national pigeonpea research program in Kenya. Int. Pigeonpea Newslett., 16, 31-36.

SINGH L., 1991. Overview of pigeonpea improvement research: objectives, achievements and looking ahead in the African context. In: Laxman S, Silim SN, Ariyanayagam RP, Reddy MV (eds). Proceedings of the first East and southern Africa regional legumes (Pigeonpea) workshop. 25-27 June 1990, Nairobi, Kenya. pp. 5-6. East Africa Regional Cereals and Legumes (EARCAL) Program, International Crops Research for the Semi-Arid Tropics.

SKERMAN J.P., 1982. Les légumineuses fouragères tropicales, FAO, Rome (Italie), 666 p.

SMARTT J., 1990. Grain legumes: evolution and genetic resources. Cambridge University Press, Cambridge, pp. 278-293.

SOLTIS D.E., SOLTIS P.S., MORGAN D.R., SWENSEN S.M., MULLIN B.C., DOWD J.M. & MARTIN P.G., 1995. Chloroplast gene sequence data suggest a single origin of the predisposition for symbiotic nitrogen fixation in angiosperms. Proc Natl Acad Sci USA, 92, 2647-2651.

SOMASEGARAN P. & HOBEN H.J., 1994. Handbook for Rhizobia. Springer verlag, New York, Inc., p. 450.

SONGOK S., MORAG F., MUIGAI A.W. & SILIM S., 2010. Genetic diversity in pigeonpea [Cajanus cajan (L.) Millsp.] Landraces as revealed by simple sequence repeat markers. African Journal of Biotechnology, 9(22), 3231-3241.

SPAINK H.P., 2000. Root nodulation and infection factors produced by rhizobial bacteria. Annu. Rev. Microbiol., 54, 257-288.

SPORE., 2010. Aide à l'agriculture «des bailleurs en ordre dispersé» N°145, pp5.

STAHL D.A. & AMMAN R., 1991. Development and application of nucleic acid probes. In nucleic acid techniques. In Bacterial systematics. Stackebrandt E. and Goodfellow M. eds., Wiley, London.

SY A., GIRAUD E., SAMBA R., DE LAJUDIE P., GILLIS M. & DREYFUS B., 2001. Certaines légumineuses du genre Crotalaria sont spécifiquement nodulées par une nouvelle espèce de Methylobacterium. Can. J. Microbiol., 47, 503-508.

SY A., GIRAUD E., JOURAND P., GARCIA N., WILLEMS A., DE LAJUDIE P., PRIN Y., NEYRA M., GILLIS M., BOIVIN-MASSON C. & DREYFUS B., 2001. Methylotrophic Methylobacterium bacteria nodulate and fix nitrogen in symbiosis with legumes. J Bacteriol., 183, 214-220.

SYLLA E.S.N., 1998. Caractérisation des rhizobiums et l'ontogenèse des nodules chez Pterocarpus erinaceus et P. lucens. Rapport de stage séjour scientifique haut niveau. LSTM, CIRAD - IRD, Montpellier, 16 p.

TA BI D.B., 2010. Influence de la fertilisation phospho -potassique sur le rendement grainier de Cajanus cajan L. Mémoire de fin d'études pour l'obtention du diplôme d'Ingénieur des Techniques Agricoles. Ecole Supérieure d'Agronomie,Yamoussoukro, 37 p.

TEREFEWORK Z., 2002. Diversity and phylogeny of Rhizobium galegae, and reflections on molecular evolution of rhizobium-legume symbiosis. In microbiology. Academic dissertation eds., University of Helsinki, pp.1239-9469.

USDA. USDA national nutrient database for standard reference, release 17, 2004, < http://www.nal.usda.gov/fnic/foodcomp>.

VANCE C.P., GRAHAM P.H. & ALLAN D.L., 2000. Biological nitrogen fixation. Phosphorus: a critical future need. In Nitrogen Fixation : From Molecules to Crop Productivity. Pedrosa F.O., Hungria M. & Yates M.G. eds., Newton WE (Kluwer Academic Publishers), Dordrecht (The Netherlands), pp. 506-514.

VAN DER MAESEN L.J.G., 1986. Cajanus DC and Atylosia W&A (Leguminosae). In Agricultural University Papers 854. Agricole University eds., Wageningen, p. 225.

VAN DER MAESEN L.J.G., 1990. Pigeonpea: origin, history, evolution, and taxonomy. In The Pigeonpea. Nene Y.H., Hall S.D., Sheila V.K. eds., CAB International UK, pp15-46.

VAN DER MAESEN, L.J.G. Cajanus cajan (L.) Millsp., 2006, (page consultée le 16 octobre 2010) < http://database.prota.org/recherche.htm>.

VANDAMME P., POT B., GILLIS M., DE VOS P., KERSTERS K. & SWINGS J., 1996. Polyphasic taxonomy, a consensus approach to bacterial systematics. Microbiol. Rev., 60, 407- 438.

VERINE T., 2008. Analyse fonctionnelle d'EFD, Un régulateur transcriptionnel de la nodulation au cours de l'interaction symbiotique entre Medicago truncatula et Sinorhizobium meliloti. Thèse de doctorat. Université Toulouse III-Paul Sabatier, Toulouse, 263 p.

VINCENT J.M., 1970. A Manual for the Practical Study of Root Nodule Bacteria. IBP handbook, no. 15. Blackwell Scientific Publications, Ltd., Oxford, England.

VISSOH P.V., GBEHOUNOU G., AHANCHEDE A., KUYPER T.W. & ROLING N.G., 2004. Weeds as agricultural constraint to farmers in Benin: results of a diagnostic study. NJAS - Wageningen Journal of Life Sciences, 52, 305-329.

WEISBURG W.G., BARNS S.M., PELLETIER D.A. & LAE D. J., 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol., 173, 697-703.

WERNER D., 1992. Symbiosis of plants and microbes. Philipps-University Marburg Germany. Edition Chapman & Hall.

WILKSON J.K., 1944. Other five hundred reasons for abandoning the cross inoculation group of legumes. Soil Sci., 58, 61-69.

WOESE C. R., 1987. Bacterial evolution. Microbiol Rev., 512, 221-71.

WOLDE-MESKEL E., BERG T., PETERS N.K. & FROSTEGARD A., 2004a. Nodulation status of native woody legumes, and phenotypic characteristics of associated rhizobia in soils of southern Ethiopia. Biol Fertil Soils, 40, 55-66.

YANN P., 2006. Apport de la génomique dans la compréhension de la symbiose Rhizobium légumineuses. Master Recherche. Microorganisme du génome aux interactions avec l'hôte. Université de Paul Sabatier. Toulouse III.

YOUNG J.P.W. & HAUKKA K. E., 1996. Diversity and phylogeny of rhizobia. New Phytol., 133, 87-94.

YOUNG N.D., MUDGE J. & ELLIS T.H., 2003. Legume genomes: more than peas in a pod. Curr Opin Plant Biol, 6, 199-204.

ZAKHIA F. & DE LAJUDIE P., 2001. Taxonomy of rhizobia. Agronomie, 21, 569-576.

ZEZE A., MUTCH L.A. & YOUNG J.P.W., 2001. Direct amplification of nodD from community DNA reveals the genetic diversity of rhizobium leguminosarum in soil. Environ. Microbial., 3(6), 363-370.

ANNEXES

 

ANNEXE I : Classification des rhizobia selon les séquences du gène de l'ARN 16S

ANNEXE I : (suite)

Les rhizobia appartiennent aux sous-classes á et â des Protéobactéries et sont dispersés dans neuf groupes monophylogénétiques. Les noms des genres et espèces connus pour établir des symbioses avec les légumineuses sont encadrés en orange (D'après SAWADA et al., 2003).

 

ANNEXE II : Présentation des structures et des laboratoires d'accueil de l'étude

Le principal laboratoire d'accueil de l'étude est celui d'Agronomie et Productions Végétales de l'Institut National Polytechnique Félix Houphouët Boigny (INP-HB) de Yamoussoukro.

1- Présentation de l'INP-HB et du Laboratoire d'Agronomie et Productions Végétales

1.1- Présentation de l'INP-HB

Créé le 4 septembre 1996 par le décret n° 96-678, l'Institut National Polytechnique Félix Houphouët Boigny (INP-HB) de Yamoussoukro est un établissement public d'enseignement supérieur et de recherche. Il est né de la restructuration et de la fusion de quatre grandes écoles, à la faveur de la dernière reforme de l'Enseignement Supérieur et de la Recherche engagée par l'Etat de Côte d'Ivoire. Il reprend, ainsi, les missions des 4 anciennes grandes écoles de Yamoussoukro que furent l'Ecole Nationale Supérieure Agronomique (ENSA), l'Ecole Nationale Supérieure des Travaux Publics (ENSTP), l'Institut Agricole de Bouaké (IAB) et l'Institut National Supérieur de l'Enseignement Technique (INSET). L'INP-HB comprend aujourd'hui six grandes écoles que sont l'Ecole Supérieure d'Agronomie (ESA), l'Ecole de Formation Continue et de Perfectionnement des Cadres (EFCPC), l'Ecole Supérieure d'Industrie (ESI), l'Ecole Supérieure des Travaux Publics (ESTP), l'Ecole des Mines et Géologie (ESMG), l'Ecole Supérieure de Commerce et d'Administration des Entreprises (ESCAE).

L'Institut compte également des Départements de Formation et de Recherche (DFR) qui ont pour mission d'effectuer des apports pédagogiques auprès des 6 écoles, de faire de la recherche, de la production et de l'expertise. Ils sont au nombre de quatorze (14) parmi lesquels le DFR Agriculture et Ressources Animales (DFR-ARA) dont dépend le laboratoire d'Agronomie et Productions végétales.

1.2- Présentation du Laboratoire d'Agronomie et Productions végétales de l'INP-HB

Le Laboratoire d'Agronomie et Productions végétales est l'un des quatre laboratoires de recherche du département ARA. Il donne un appui à la formation, par des travaux pratiques et travaux de fin d'études d'étudiants. Il est aussi le cadre d'activités des enseignants-chercheurs qui abordent de nombreux thèmes dont les principaux sont ci-dessous indiqués :

- Amélioration génétique du riz ;

- Instabilité de la variété de riz NERICA 2 ;

- Rendement du riz et ses composantes en fonction de la fertilisation azotée ;

- Productivité des principales cultures maraîchères en zone urbaine et périurbaine ;

- Caractérisation des systèmes agro-pastoraux : cas de la région des montagnes ;

- Approche régionale des systèmes de culture, de production et agraires ;

- Efficacité des légumineuses selon différentes souches de Rhizobium (ANONYME, 2009).

Le thème d'étude s'inscrit dans le champ du dernier thème de recherche.

La conduite de cette étude a nécessité une collaboration technique avec le Laboratoire Central de Biotechnologie du Centre National de Recherche Agronomique (CNRA). Il est important de souligner que cette collaboration a été possible grâce au partenariat existant entre l'INP-HB et cette structure.

2- Présentation du CNRA et du Laboratoire Central de Biotechnologie (LCB)

2.1- Présentation du Centre National de Recherche Agronomique (CNRA)

Le Centre National de Recherche Agronomique (CNRA) est une société anonyme à participation financière publique minoritaire. Le capital social, de 500 millions, est détenu pour 40% par l'Etat de Côte d'Ivoire et pour 60% par les opérateurs agricoles et agro-industriels opérant dans le pays.

Créé en 1998, il remplace les trois anciens instituts de recherche agronomique ivoiriens suivants :

- l'Institut Des Savanes (IDESSA) ;

- l'Institut Des Forêts (IDEFOR) ;

- le Centre Ivoirien de Recherche Technologique (CIRT).

L'objet du Centre National de Recherche Agronomique se décline en trois points essentiels dont celui de l'accroissement de façon durable de la production et de la productivité dans les domaines agricole et agro-industriel. Il s'agit à travers ce point de faire d'une part, des recherches sur les productions végétales, animales et forestières, sur les méthodes de conservation et de transformation etc. D'autre part, il s'agit de transférer les acquis scientifiques et techniques et de valoriser l'expertise des ressources humaines auprès des opérateurs publics et privés, locaux et extérieurs (ANONYME, 2008).

Le CNRA dispose de cinq directions régionales (Abidjan, Gagnoa, Bouaké, Korhogo et Man) et vingt stations de recherche correspondant aux différents programmes de recherche du centre. Le laboratoire central de biotechnologie qui a servi de cadre pour nos travaux conduit le programme de biotechnologie.

3.2.2- Présentation du Laboratoire Central de Biotechnologie (LCB) du CNRA

Le LCB est rattaché à la direction régionale d'Abidjan du CNRA. Il est situé à Adiopodoumé et composé de six unités opérationnelles spécialisées qui sont :

- l'unité de génétique moléculaire ;

- l'unité de génomique fonctionnelle ;

- l'unité de virologie et biologie moléculaire ;

- l'unité de ressource génétique ;

- l'unité de microbiologie ;

- l'unité de phytopathologie.

Sa mission est de faire la recherche en exploitant, transférant et vulgarisant les acquis de la biotechnologie au profit de la production agricole et de la gestion rationnelle des ressources génétiques.

L'unité de virologie et de biologie moléculaire du laboratoire  a été particulièrement sollicitée pour notre étude.

ANNEXE III : Composition du milieu TY (Tryptone Yeast Agar) en g/l (BERINGER, 1974)

Tryptone 5

Extrait de levure 3

CaCl2 H2O 0.87

Eau distillée 1000 ml

Agar 12

pH 6,8

Autoclavage 120 °C pendant 20 minutes.

* 1 « HELLRIEGEL et WILFART, 1888 cités par EL HILALI, 2006 »

* 2 « BEYERINCK, 1888 cité par EL HILALI, 2006 »

* 3 « WORONIN, 1866 cité par EL HILALI, 2006 »

* 4 «  FRANK, 1879 cité par EL HILALI, 2006 »

* 5 « HELLRIEGEL et WILFARTH, 1888 cités par EL HILALI, 2006 »

* 6 « BEYERINCK, 1888 cité par EL HILALI, 2006 »

* 7 «  FRANK, 1889 cité par EL HILALI, 2006 »






La Quadrature du Net