WOW !! MUCH LOVE ! SO WORLD PEACE !
Fond bitcoin pour l'amélioration du site: 1memzGeKS7CB3ECNkzSn2qHwxU6NZoJ8o
  Dogecoin (tips/pourboires): DCLoo9Dd4qECqpMLurdgGnaoqbftj16Nvp


Home | Publier un mémoire | Une page au hasard

 > 

Polymorphisme des antigenes plaquettaires humains dans la population tunisienne

( Télécharger le fichier original )
par Mabrouka LASSOUED
Université de Tunis El Manar - Mastère de Génétique et Bio-ressourses 2007
  

précédent sommaire suivant

Bitcoin is a swarm of cyber hornets serving the goddess of wisdom, feeding on the fire of truth, exponentially growing ever smarter, faster, and stronger behind a wall of encrypted energy

II-3. Mise au point de la réaction PCR-SSP

Dans le but de faire le génotypage des cinq systèmes HPAs, six couples d'amorces sens et anti-sens) ont été utilisés : un couple d'amorces pour amplifier une région du gène HGH. Les autres pour amplifier les régions spécifiques sont complémentaires à la séquence à amplifiés. Toutes ces amorces sont de types séquences spécifiques (SSP), elles sont capables de détecter les versions alléliques des différents gènes codants.

Dans notre étude, la Taq a été diluée dans le tampon 1X a partir d'une solution mère dont la concentration est de 5U/ul. 

Nous avons utilisé une méthode basée sur la réaction de (PCR-SSP) comme décrite par Cavanagh et al. (Metcafle et al., 1993; Cavanagh. G et al., 1997), avec quelques modifications. La mise au point de la PCR a nécessité un changement chaque fois d'un paramètre, afin d'optimiser et choisir le protocole standard pour chaque technique. Plusieurs paramètres peuvent constituer des éléments critiques pour le succès de la technique d'amplification. Une gamme de MgCl2 doit être testée afin de déterminer la concentration optimale du magnésium permettant une bonne amplification. En effet, une forte concentration en ions Mg++ peut engendrer des polymérisations aspécifiques, alors q'une faible quantité diminue le taux d'amplification. Les autres composants de la PCR peuvent aussi influencer le déroulement de la polymérisation. Le pH doit rester constant et correspondre au pH optimal de l'enzyme utilisée. De même, la température de dénaturation de l'ADN matrice, de l'hybridation et de l'élongation peuvent être des facteurs limitants. Le chois des séquences oligonucléotidiques servant comme amorces (% en GC) peut constituer à son tour un paramètre essentiel intervenant surtout au moment de l'hybridation conduisant a la formation de structures secondaires.

Cependant, nous avons rencontré des difficultés pour l'amplification de tous les allèles, à cause de l'amplification non spécifique car ces systèmes ont exigé des conditions optimales pour leur amplification. Ces difficultés ont été résolues par une légère modification de la technique utilisée par Cavanagh et al. Nous avons donc essayé d'améliorer la spécificité de la PCR-SSP en augmentant la concentration du magnésium MgCl2 de 1,5 mM à 2,5 mM dans le mélange de la réaction finale.

Chaque système bi-allélique est analysé à l'aide de deux couples d'amorces spécifiques auxquels est ajouté un couple d'amorces monomorphiques servant de témoin d'amplification. Des ADN de référence portant les différents allèles testés auparavant sont nécessaires et ont été obtenus à partir d'individus typés par PCR et avec d'autres méthodes. Au cours de la mise au point, nous avons choisi des températures d'hybridation Th spécifiques pour l'amplification des systèmes HPA-1 et HPA-3 (55C), HPA-2 et HPA-5 (56C) et (63C) pour le système HPA-4. Les Tm des amorces des allèles HPA-1a /HPA-1b (62 C /64 C) et HPA-3a /HPA-3b (64 C /66 C) sont supérieures aux températures d'hybridation. Quant au Th du système HPA-4 (63C) et au Th HPA-5 (56C), ils sont supérieures au Tm (62C pour HPA-4 et 42C pour HPA-5. Concernant le système HPA-2, le Th (56 C) est inférieur au Tm (64C). Nous savons que les réactions d'extension d'amorce sont faites à des températures proches, mêmes supérieures aux Tm des amorces qui en conséquence pourraient ne pas avoir le temps de s'hybrider correctement et ainsi provoquer le décrochage de l'enzyme après son arrivée. Néanmoins, nous avons trouvé de bons résultats avec des Th < Tm pour les trois systèmes HPA-1, HPA-2 et HPA-3. Nous avons choisi des températures d'hybridation spécifiques identiques pour les systèmes HPA-1 et HPA-3 (55C) et pour les systèmes HPA-2 et HPA-5 (56C). Ainsi, nous pouvons amplifier les deux systèmes HPA-1 et HPA-3 ensemble et les deux systèmes HPA-2 et HPA-5 ensemble avec le même programme PCR.

Nous avons utilisé les mêmes concentrations du mix pour tous les systèmes sauf pour les primers spécifiques. En fait, nous avons utilisé la concentration 0,35 mM pour les trois systèmes HPA-1, HPA-2, et HPA-4, tandis qu'on a augmenté cette concentration à 0,5 mM pour les systèmes HPA-3 et HPA-5.

II-3-4- Préparation des solutions stocks 

Préparation des dNTPs : Pour préparer le stock des dNTPs, on mélange volume à volume les quatre solutions mères (100 mM) contenant chacune un type de base (dATP, dCTP, dTTP, dGTP), ce qui donne une concentration de 25mM correspondant à chaque

dNucléotides. La solution subira une dilution pour obtenir la concentration adéquate de 2Mm (20ul + 920ul d'eau bidistillée). Ce mélange préparé dans un tube eppendorfs (1,5ml) est conservé à -20C pour des utilisations ultérieures.

Préparation de la solution de MgCl2 : On mélange volume à volume MgCl2 à une concentration initiale de 25 mM et l'eau distillée pour obtenir une solution de MgCl2 dont la concentration est de 12,5 mM.

Préparation des solutions d'amorces : les amorces oligonucléotidiques nous ont été fournies sous forme solubilisée. Les solutions mères d'amorces doivent être diluées dans des tubes eppendorfs (1,5ml) pour avoir une concentration de 2 ; 3,5 ou 5 uM suivant le type d'amorce puis conservées à -20C pour des utilisations ultérieures 10X concentrées. IL faut faire attention à toute contamination possible.

Pour chaque réaction PCR, on utilise une paire d'amorces spécifiques à chaque système HPA (sens et anti-sens). Ils doivent être apportés en excès afin de favoriser leurs liaisons aux brins d'ADN dénaturés plutôt que celles des brins d'ADN entre eux. Un deuxième couple d'amorces désignées à l'amplification d'une région du gène HGH, gène monomorphe codant l'hormone de croissance chez l'homme, a été utilisé comme contrôle de qualité (contrôle interne) pour les différentes étapes d'extension d'ADN pour vérifier l'efficacité de la réaction d'amplification témoignant le succès de la réaction PCR.

Les amorces utilisées sont comparées aux séquences connues dans la base de données NCBI selon les étapes suivantes :

1- Aller sur le site NCBI.

http: www.ncbi.nlm.nih.gov/

2- Retrouver la séquence du gène.

3- Récupérer la séquence du gène sous sa forma fasta.

4- ouvrir une page blast 2 séquences.

http://www.ncbi.nlm.nih.gov/BLAST/bl2seq/wblast2.cgi.

On a deux boites on colle la séquence de l'amorce (forma fasta) dans l'une et celle du gène dans l'autre et on clique sur le bouton Align.

Ces amorces utilisées pour chaque région amplifiée sont les suivantes :

Tableau V : Les différents couples d'amorces utilisés pour l'amplification spécifique des systèmes HPA -1 à 5 (Cavanagh. G et al., 1997).

HPAs

spécificité

Amorces : sens 5' - 3'

Concentration finale (ìM/ìl)

Taille pb

TmC

HPA-1

HPA-1a

HPA-1b

HPA-As

5'TCACAGCGAGGTGAGGCCA 3'

5'TCACAGCGAGGTGAGGCCG 3'

5'GGAGGTAGAGAGTCGCCATAG 3'

0,35

90

62

64

50

HPA-2

HPA-2a

HPA-2b

HPA-As

5'GCCCCCAGGGCTCCTGAC 3'

5'GCCCCCAGGGCTCCTGAT 3'

5'TCAGCATTGTCCTGCAGCCA 3'

0,35

258

64

62

62

HPA-3

HPA-3a

HPA-3b

HPA-As

5'TGGACTGGGGGCTGCCCAT 3'

5'TGGACTGGGGGCTGCCCAG 3'

5'TCCATGTTCACTTGAAGTGCT 3'

0,5

267

64

66

50

H PA-4

HPA-4a

HPA-4b

HPA-As

5'GCTGGCCACCCAGATGCG 3'

5'GCTGGCCACCCAGATGCA 3'

5'CAGGGGTTTTCGAGGGCCT 3'

0,35

120

62

62

62

HPA-5

HPA-5a

HPA-5b

HPA-As

5'AGTCTACCTGTTTACTATCAAAG 3'

5'AGTCTACCTGTTTACTATCAAAA 3'

5'CTCTCATGGAAAATGGCAGTA 3'

0,5

246

42

42

50

Control positive HGH

HGH-s

HGH-As

5'GCCTTCCCAACCATTCCCTTA 3'

5'TCACGGATTTCTGTTGTGTTTC 3'

0,2

429

57

52

S: sens

As : antisens

v Préparation du master Mix 

Après la mise au point on prépare, dans un tube eppendorf, un master mix (tampon, dNTP, les primers, MgCl2) pour le typage de 100 échantillons, pour des raisons de bonne conservation du produit, un aliquot est préparé selon les besoins. Ces tubes doivent être conservés au congélateur dans le but d'éviter la congélation et la décongélation des produits.

v Préparation du Super-Mix 

A chaque fois qu'on fait le typage, on laisse le master mix à température ambiante jusqu'à la décongélation puis on ajoute la Taq diluée dans le tampon 1X pour obtenir un super mix qui doit être réparti dans des tubes PCR à raison de 8ul/tube.

De grandes précautions doivent être prises vis à vis de la Taq polymérase qui demande à être conservée à -20C sans écart de température afin d'éviter sa dégradation.

v Préparation d'un milieu réactionnel PCR-SSP 

En dernière étape, on ajoute à chaque tube PCR 2ul d'ADN à 100ng/ul des échantillons à tester. Le tout est mélangé doucement pour ne pas altérer l'enzyme. Le volume final est de 10 ul contenant au moins 200 ng d'ADN génomique. Les facteurs limitants l'amplification sont l'épuisement des amorces et celui des nucléotides. La spécificité d'amplification d'une séquence donnée sera directement liée a celle des amorces choisies. Pour chaque PCR, un tube sans ADN (à la place de l'ADN, on met de l'eau distillée), qui sert comme témoin négatif, permet de s'assurer de l'absence de contamination. Il faut bien choisir de «bons» témoins positifs et négatifs. Puis, on amplifie l'ADN.

Le mélange réactionnel est composé comme suit :

Tableau VI : Composition d'un milieu réactionnel 

Ingrédients

Concentration initiale

Concentration finale

Vo (ul) ×N

Tampon

5X

1X

2

MgCl2

12.5 mM

2.5 mM

0.8

dNTPs

2.5 mM

200 uM

0.2

Primers spécifiques sens

3.5* ou 5** uM

0.35* ou 0.5** uM

1

Primers spécifiques anti-sens

3.5* ou 5** uM

0.35* ou 0.5** uM

1

Primers

HGH-sens

2 uM

0.2 uM

1

Primers

HGH-antisens

2 uM

0.2 uM

1

Taq

3.5 U /ul

0.35 U

1

ADN

100 ng

200 ng

2

Volume total

 
 

10

*HPA-1, HPA-2 et HPA-4

ou

**HPA-3 et HPA-5.

II-3-5- Amplification des cinq premiers systèmes plaquettaires 

Nous avons adopté la technique PCR-SSP : c'est la technique la plus utilisée pour l'étude du polymorphisme allélique des gènes des différents systèmes HPAs. Elle a l'avantage d'être une méthode en une seule étape où la spécificité de primer simplifie la détection du produit amplifié. C'est une technique simple, rapide et précise (Skogen B et al. 1994). Cette méthode exige des conditions particulières d'amplification pour les différents systèmes.

II-3-6 - Programmes PCR 

Chaque série d'amplification comporte différentes étapes selon un programme bien déterminé. Tous les éléments nécessaires à la réaction sont regroupés dans un tube PCR qui sera soumis aux différentes températures correspondant à chaque étape. Ces cycles de température sont réalisés automatiquement dans un thérmocycleur. L'amplification est effectuée en 30 cycles qui sont précédés par une étape de dénaturation de 5 mn à 95C qui rend la dénaturation initiale efficace. Elle consiste en une minute de dénaturation à 95C, une minute d'hybridation à une température spécifique pour chaque système et une minute d'extension à 72C. Les Thyb (température d'hybridation) mises au point pour chaque couple utilisé pendant la réaction d'amplification sont mentionnées dans le (Tableau VIII). A la fin, ces cycles sont suivis d'une étape d'élongation de 7 min à 72C afin que la polymérase termine la synthèse des brins qu'elle n'a pas eu le temps de finir pendant les cycles précédents. Cette étape fixe donc la fin de l'élongation et achève ainsi la réaction PCR. Ces cycles sont réalisés automatiquement dans un thérmocycleur Perkin Elmer 2700 programmé pour effectuer les cycles suivants. La température d'hybridation «Thyb »

Tableau VII : Programme PCR utilisé :

Nbr de cycles

Température

Etape

Temps

1

95C

Dénaturation

5

30

94C

Dénaturation

1 min

HPA-1

55C

Hybridation

1 min

HPA-2

56C

HPA-3

55C

HPA-4

63C

HPA-5

56C

72C

Elongation

1 min

1

72C

Elongation finale

7 min

+8

4 C

Arrêt

+8

précédent sommaire suivant






Bitcoin is a swarm of cyber hornets serving the goddess of wisdom, feeding on the fire of truth, exponentially growing ever smarter, faster, and stronger behind a wall of encrypted energy








"Là où il n'y a pas d'espoir, nous devons l'inventer"   Albert Camus