WOW !! MUCH LOVE ! SO WORLD PEACE !
Fond bitcoin pour l'amélioration du site: 1memzGeKS7CB3ECNkzSn2qHwxU6NZoJ8o
  Dogecoin (tips/pourboires): DCLoo9Dd4qECqpMLurdgGnaoqbftj16Nvp


Home | Publier un mémoire | Une page au hasard

 > 

Bio-écologie des anophèles de part et d'autre de la falaise des Mbô et leur implication dans la transmission du paludisme d'altitude

( Télécharger le fichier original )
par Billy TENE
Université de Yaoundé 1 - DEA 2007
   Télécharger le fichier original

Disponible en mode multipage

UNIVERSITE DE YAOUNDE I FACULTE DES SCIENCES

The University of Yaoundé I Faculty of Sciences

Département de Biologie et Physiologie Animales

Department of Animal Biology and Physiology

Bio-écologie des anophèles de part et d'autre de la falaise des Mbô et leur implication dans la transmission du paludisme d'altitude

MEMOIRE

Présenté et soutenu en vue de l'obtention du

Diplôme d'Etudes Approfondies (DEA) deBIOLOGIE ANIMALE

Option : Parasitologie

Par :

TENE FOSSOG Billy

Maître es Sciences

Sous la direction de :

Dr. Timoléon TCHUINKAM

Chargé de Cours

Université de Dschang

Dr. Frédéric SIMARD

Chargé de recherche

IRD, Montpellier

Pr. Thomas NJINE

Professeur

Université de Yaoundé I

Année académique 2006-2007

DEDICACE

Je dédie ce travail à :

· Mesparents, Mr et Mme FOSSOG,

· Messoeursetmonfrère :Viviane,LauretteetVerlaine ;

Pour toute l'affection et les sacrifices consentis à mon égard, que ce travail en soit le couronnement.

REMERCIEMENTS 

Ce travail a été réalisé à l'OCEAC (Organisation de Coordination pour la lutte contre les Endémies en Afrique Centrale), dans le Laboratoire de Recherche sur le Paludisme de l'IRD (Institut de Recherche pour le Développement) avec le soutien financier du programme JEA (Jeunes équipes associées) du Département Soutien et Formation (DSF) de l'IRD. J'exprime ici ma profonde gratitude à l'endroit de ces deux organisations (IRD et OCEAC) qui offrent un grand appui académique et logistique aux jeunes étudiants Africains.

Au moment où ce travail s'achève, il m'est agréable d'adresser ma profonde gratitude à tous ceux qui ont contribué à sa réalisation, tout particulièrement :

· Monsieur le Secrétaire Général de l'OCEAC, le Dr Jean-Jacques MOKA, Son Directeur de Cabinet Mr Fulgence LIKASSI-BOKAMBA et autres collaborateurs, pour m'avoir accordé un stage académique dans cette institution ;

· Pr Thomas NJINE pour avoir accepté de diriger ce travail,qu'il reçoive ici toute ma reconnaissance ;

· Dr Fréderic SIMARD qui m'a accepté au sein du laboratoire de l'OCEAC et a toujours fait preuve d'une grande humilité envers tous les jeunes stagiaires ;

· Dr Timoléon TCHUINKAM qui m'a accueilli au sein de sa jeune équipe de recherche JEA-IRD, dénommée "Paludisme d'altitude",et a été l'instigateur de ce travail. Son attention et ses conseils, malgré ses nombreuses occupations, ont été très utiles ;

· Les enseignants du Département de Biologie et Physiologie Animales de l'Université de Yaoundé I, en particulier ceux de l'option Parasitologie dont je suis un humble produit.

· Dr Isabelle MORLAIS dont les suggestions et conseils précis m'ont permis de surmonter de bien grandes difficultés, soyez assurée de toute ma reconnaissance ;

· Dr Clément KERAHet Parfait AWONO pour leurs disponibilité et suggestions importantes pour la réalisation de ce document ;

· Dr Josiane ETANG et Christophe ANTONIO-NKONJIOpour leurs conseils et encouragements ;

· Les techniciens du laboratoire de paludisme MM. Roger BEYENE, Rose NYAMBAN et Sylvie KEMLEU pour m'avoir initié aux différentes techniques entomologiques et de biologie moléculaire ;

· Mes ainés du laboratoire : Mouhamadou CHOUAIBOU, Elyzée NCHOUTPOUEN, Collince KAMDEM, Philippe NWANE, Cyrille NDO et Jacqueline DOMFANG pour leur assistance technique et leurs suggestions ;

· Mes camarades Basile KAMGANG, Sandrine NSANGO, Wilson TOUSSILE pour leur collaboration ;

· Les étudiants de la JEA-IRD de Dschang : Espérance LELE, Aimé TATENG et Bénédicte MAKE pour leurs appui et disponibilité lors des missions de terrain ;

· La dynamique équipe des "captureurs" volontaires de Dschang et Santchou ainsi que ceux qui ont accepté que les captures se fassent dans leur domicile ;

· Mes camarades de promotion NAGA NDONGO, Gui LEKEFACK, Ida MBARGA, Emmanuel ELANGA et tous les autres que je n'oublie pas, pour leur collaboration ;

· Mes amis Alex KWAYA, Arnold BITJA, Charles FOKOUE, Didier NJAMEN, Dimitri BOGNING,Gislain MBA, Lamine MOUNDI, Patrick YWONGet YOMBO AKADApour leurs encouragements ;

· Tous ceux dont les noms ne sont pas cités ici, et qui de près ou de loin on participés à la réalisation de ce travail.

Je ne saurai terminer sans remercier le Seigneur Dieu qui m'a fourni toute l'énergie et l'intelligence nécessaires à l'accomplissement de tout ceci.

RESUME

Les hautes terres africaines sont reconnues comme zones à risque d'épidémies palustres, ce qui est surprenant car le climat froid des zones d'altitude rallonge le cycle extrinsèque des parasites et limite le développement des vecteurs. En vue d'examiner le cas des Hauts plateaux Bamiléké dans l'ouest Cameroun, nous nous sommes proposés d'étudier les variations des populations anophéliennes présentes de part et d'autre de la falaise des Mbô et les changements du niveau de transmission du paludisme le long de ce transect altitudinal.

La collecte des spécimens a été réalisée dans deux localités : Santchou dans la plaine inondable des Mbô à 750m d'altitude et Dschangsur le plateau à 1400m d'altitude, les deuxséparées par une falaise forestière. Elle a été réaliséeà chacune des 4 saisons de l'annéepar pulvérisation intra domiciliaire de pyrèthre et capture nocturne sur volontaires, pendant 2 ans.

A Dschang, 9 espèces anophéliennesont été récoltées : An. gambiaes.s.,An. funestus, An. paludis,An. hancocki, An. nili, An. coustani, An. wellcomei, An. ziemannietAn. moucheti. A Santchou, 10 espèces ont été récoltées dont 8 des espèces précédentes (à l'exception de An. moucheti)auxquelles s'ajoutentAn. namibiensis et An. pharoensis.

L'espèceAn. gambiaes.s. (exclusivement de forme moléculaire S)a été le vecteur principal toute l'année, avec une fréquence de 84,46% à Santchou et 90,30% à Dschang et des indices sporozoïtiques (Is) de 1,80 et 2,35 respectivement, déterminés par le test ELISA-CSP. Elle était secondée parAn. funestus dont les fréquences sont respectivement de4,73% et 7,83% et l'Is de 1,02 et 4,20. Cette dernière a joué un rôle assez important dans la transmission en saison sèche à Dschang avec un Is supérieur à celui de An. gambiae (4,20 et 2,35 respectivement) lorsque l'agressivité de An. gambiae était minimale.Les autres espèces dont les fréquences étaient inférieures à 6,5%n'étaient pas porteuses du parasite.

L'agressivité moyenne a été plus élevée dans la plaine (9,34 p/h/n) que sur le plateau (5,29 p/h/n), mais le taux d'inoculation entomologique n'a pas présenté une aussi grande différence ;respectivement 51,84 pi/h/anavec une transmission saisonnière et 47,68 pi/h/an avec une transmission pérenne. La baisse de température en altitude a rallongé la durée du cycle gonotrophique d'un jour pour les 2 vecteurs, ce qui a doubléla durée de l'espérance de vie infectante par rapport à la plaine. Malgré cela, ces deux vecteurs réussissent à maintenir le niveau de stabilitédu paludisme à 3,43 à Santchou c'est-à-dire au dessus du seuil de stabilité qui est de 2,5 ; et à 2,04 à Dschang donc une stabilité intermédiaire.

Mots clés :Altitude, Cameroun,Paludisme, Transmission, An. gambiae,An. funestus

ABSTRACT

There is a consensus that malaria is a growing problem in African highlands. This is surprising because the cold climate of high altitude areas lengthens the extrinsic cycle of the parasites and limits the development of vectors. In this report, we examined the case of the Beamlike highlands in the Western Cameroon.In this case, we proposed to study the variations of the anopheline populations present on both sides of the Mbô cliff and the changes in the level of malaria transmission along this altitudinal transect.

Routine entomological collections were carried out in two localities: Santchou in the easily flooded plain of Mbô at 750m above sea level and Dschang in highlands (1400m altitude), both separated by a forest cliff. They were madeonce at each season by indoor spray catches and human landing catches, during two years.

Nineanopheline species were collectedin Dschang: An. gambiae s.s., An. funestus, An. paludis, An. hancocki, An. nili, An. coustani, An.wellcomei,An. ziemanni and An. moucheti. In Santchou, 10 species were listed including 8 of the preceding species (except An. moucheti) to which were added An. namibiensis and An. pharoensis.

Anophelesgambiae s.s.(exclusively of S molecular form) was the principal vector throughoutthe year, with a frequency of 84.46% in Santchou and 90.30% in Dschang and sporozoïterates of 1.80 and 2.35 respectively, determined by CSP-ELISA test. He was assisted byAn. funestus whose frequencies were respectively 4.73% and 7.83% and sporozoïterate of 1.02 and 4.20. The latter played a rather significant role in the transmission in dry season in Dschang with a sporozoïterate higher than that of An. gambiae (4.20 and 2.35 respectively) when the aggressiveness of An. gambiae was minimal. The other species whose frequencies were lower than 6.5% were not carrying the parasite.

Average aggressiveness was higher in the plain (9.34 bite/men/night) than on the plateau (5.29 b/m/n), but the entomological inoculation rate did notpresentsuch a great difference; respectively 51.84 infectiousbite/men/yearwith a seasonal transmission and 47.68 ib/m/ywith a perennial transmission. The fall of temperature in altitude lengthened the gonotrophic duration of the cycle of the 2 vectorsfor a day, which doubled the duration of the infecting life expectancy compared to the plain. In spite of that, these two vectors succeed in maintaining the level of malaria stability at3.43 in Santchou i.e. above the threshold of stability which is 2.5; and to 2.04 in Dschang thus an intermediate level of stability.

Key words: Highlands, Cameroon, Malaria, Transmission, An. gambiae, An. funestus

SOMMAIRE

Dédicace i

Remerciements ii

Résume iv

Abstract v

Sommaire vi

Liste des figures ix

Liste des tableaux x

Liste des abréviations xi

INTRODUCTION 1

Chapitre 1 : GENERALITES. 4

1.1. LE PALUDISME 5

1.1.1. Historique du paludisme 5

1.1.2. La transmission du paludisme 5

1.1.3. La maladie 6

1.2. LES AGENTS PATHOGENES 6

1.2.1. Position systématique des Plasmodiums 6

1.2.2. Les Plasmodiums humains 7

1.2.3. Cycle évolutif de Plasmodium falciparum 8

1.2.3.1. Chez l'hôte vertébré (homme) 8

1.2.3.2. Chez l'hôte invertébré (moustique vecteur) 9

1.3. LES VECTEURS 11

1.3.1. Position systématique des anophèles 11

1.3.2. Généralités 11

1.3.3. Cycle de vie des Anophèles 13

1.3.3.1. Les oeufs 13

1.3.3.3. Les larves 13

1.3.3.3. Les nymphes 13

1.3.3.4. Les adultes 14

1.3.4. Les principaux vecteurs du paludisme au Cameroun 14

1.3.4.1. Le complexe Anopheles gambiae 16

1.3.4.2. Le groupe Anopheles funestus 17

1.3.4.3. Le groupe Anophelesmoucheti 17

1.3.4.4. Le groupe Anopheles nili 17

1.4. TECHNIQUES D'ECHANTILLONNAGE DES CULICIDES 18

1.4.1. Collecte des stades pré-imaginaux 18

1.4.2. Récolte des moustiques endophiles (faune résiduelle) 18

1.4.2.1. Récolte à l'aspirateur de moustiques endophiles 18

1.4.2.2. Capture au pyrèthre de moustiques endophiles 18

1.4.3. Capture des moustiques exophiles 18

1.4.4. Capture sur volontaires humains et sur appâts animaux 19

1.5. MESURE DES INDICES ENTOMOLOGIQUES ET EPIDEMIOLOGIQUES 19

1.6. LE CONTRÔLE DU PALUDISME 22

1.6.1. La lutte antivectorielle 22

1.6.1.1. Lutte contre les stades larvaires 22

1.6.1.2. Lutte contre les adultes 22

1.6.2. La prise en charge des malades 23

1.7. HYPOTHESES ET OBJECTIFS DE L'ETUDE 24

Chapitre 2 : MATERIEL  ET  METHODES. 25

2.1. SITES D'ETUDE 26

2.1.1. Dschang 26

2.1.2. Santchou 28

2.2. COLLECTE DES MOUSTIQUES 30

2.2.1. La capture sur volontaires 30

2.2.2. La capture par pulvérisation intra-domiciliaire d'insecticide 30

2.3. IDENTIFICATION DES MOUSTIQUES 30

2.3.1. Identification morphologique 31

2.3.3. Identification moléculaire 31

2.3.3.1. Identification des membres du complexe An gambiae 31

2.3.3.2. Détermination des formes moléculaires de An. gambiae s.s. 33

2.4. DETERMINATION DE L'INFESTATION DES ANOPHELES 34

2.5. ANALYSE DES DONNEES 35

Chapitre 3 : RÉSULTATS  ET  DISCUSSION 36

3.1. LA FAUNE ANOPHELIENNE 37

3.1.1. Composition spécifique de la faune anophélienne 37

3.1.2. Productivité des différentes techniques de capture 37

3.1.3. Variations saisonnières des populations anophéliennes 39

3.2. STRUCTURE DU COMPLEXE ANOPHELES GAMBIAE 39

3.2.1. Composition du complexe Anopheles gambiae 39

3.2.2. Formes moléculaires de Anopheles gambiae s.s. 39

3.3. VARIATIONS DE LA COMPOSITION SPECIFIQUE ET DES INDICES ENTOMOLOGIQUES AVEC L'ALTITUDE 39

3.3.1. Variation de la composition spécifique de la faune anophélienne 39

3.3.2. Le cycle d'agressivité 41

3.3.3. Comparaison des indices sporozoïtiques 43

3.3.4. Effet de l'altitude sur l'agressivité, le taux d'inoculation entomologique et l'indice de stabilité 43

3.4. DISCUSSION 46

3.4.1. Composition de la faune anophélienne 46

3.4.2. Comparaison des populations de vecteurs à différents niveaux altitudinaux 46

3.4.3. Composition du complexe An. gambiae 48

3.4.4. Les niveaux de transmission du paludisme. 49

CONCLUSION ET PERSPECTIVES 51

RÉFÉRENCES BIBLIOGRAPHIQUES 53

ANNEXES 61

LISTE DES FIGURES

Figure 1 : Cycle de développement du Plasmodium chez l'Homme et l'Anophèle vecteur 2

Figure 2 : Comparaison des principaux genres de Culicidés. 12

Figure 3 : Cycle biologique des Anophèles 15

Figures 4 (a et b) : Anophèle femelle à jeun (a) et Anophèle femelle gorgée (b) 15

Figure 5 : Répartition des cases de captures à Dschang 27

Figure 6 : Carte de la région de la plaine des Mbô 29

Figure 7 : Programmation du thermocycleur pour la PCR complexe An. gambiae 32

Figure 8 : Schéma du principe de la technique "ELISA sandwich" 34

Figure 9 : Densités des anophèles en fonction du mode de récolte des échantillons à Dschang et Santchou d'août 2004 à novembre 2006 37

Figure 10 : Profil de migration des différents membres du complexe An. gambiae 40

Figure 11 : Profil de migration sur gel d'agarose des spécimens de forme moléculaire M et S de An. gambiae s.s. 40

Figure 12 : Cycles d'agressivité des principaux vecteurs du paludisme à Santchou et Dschang d'août 2004 à novembre 2006. 42

LISTE DES TABLEAUX

Tableau 1 : Localisation des sites de capture en fonction de l'urbanisation à Dschang 2

Tableau 2 : Localisation des sites de capture en fonction de l'urbanisation dans la plaine 28

Tableau 3 : Composition spécifique de la faune anophélienne de Dschang et Santchou d'août 2004 à novembre 2006 38

Tableau 4 : Variations saisonnières de la faune anophélienne à Dschang et Santchou d'août 2004 à novembre 2006 38

Tableau 5 : Variation nocturnes des densités et fréquences des principaux vecteurs du paludisme avec l'altitude à Santchou et Dschang d'août 2004 à novembre 2006. 42

Tableau 6 : Comparaison des indices sporozoïtiques (Is) de P. falciparum détectés par le test ELISA-CSP chez les anophèles respectivement à Santchou et Dschang d'août 2004 à novembre 2006 44

Tableau 7 : Influence de l'altitude sur le taux d'inoculation entomologique et l'indice de stabilité à Santchou et Dschang d'août 2004 à novembre 2006 45

LISTE DES ABREVIATIONS

ul : microlitre

ACm : anticorps monoclonal

ACT : Artemisinin-based Combination Therapy

ADN : Acide désoxyribonucléique.

Ae. : Aedes

An. : Anopheles

ARN : Acide ribonucléique.

CNV : Capture nocturne sur volontaires

CPI : Capture par pulvérisation intradomiciliaire d'insecticide

CSP : Circumsporozoïtique

dNTP : dinucléotide triphosphate

ed : Eau distillée

EDTA : Ethylene Diamine Tetra-acetic Acid

ELISA : Enzyme Linked ImmunoSorbent Assay

MINSANTE : Ministère de la Santé du Cameroun

MSP : Ministère de la Santé Publique du Cameroun

OCEAC : Organisation de Coordination pour la lutte contre les Endémies en Afrique

Centrale

OMS : Organisation Mondiale de la Santé

P. Plasmodium

p/h/n : Piqûres par homme et par nuit

pi/h/an : Piqûres infectantes par homme par an

PCR : Polymerase Chain Reaction

pH : Potentield'hydrogène

RADP : Random amplified polymorphic DNA

RFLP : Restriction Fragment Length Polymorphism

s.l. : sensu lato

s.s. : sensu stricto

STR : Short tandem repeat

TBE : Tris-borate-EDTA

TEMED : N, N, N', N' tetra methyl ethylene diamine

Tp : Taux de parturité

Tris-HCl : Tris-hydrochloryde

UNICEF : United Nations Children's Fund

INTRODUCTION

En Afrique tropicale, lepaludisme est l'une des endémies parasitaires les plus répandues etla plus grandes causes de morbidité et de mortalité, surtout chez les nouveau-nés et les enfants de moins de 5ansqui, avec les femmes enceintes, représentent les groupes les plus atteints. En 2003, le paludisme a menacé environ 2,5 milliards de personnes dans le monde et a causé le décès de 1 à 2,5 millionsd'entre eux (OMS/UNICEF, 2003). Plus de 80 des décès par paludisme se produisent en Afrique subsaharienne où l'on estime que 60 de la population est exposée au risque palustre et près de deux millions de personnes en meurent par an (OMS, 2005).

Son impact au Cameroun est considérable :

- 2 millions de cas ;

- 45% de consultations médicales ;

- 35 à 40% de décès dans les formations sanitaires ;

- 50% de morbidité et 40% de décès chez les enfants de moins de 5 ans ;

- 40% de dépenses annuelles des ménagespour la santé (Samé Ekobo, 2005; MSP, 2001).Cette affection est une érythrocytopathie due à la multiplication et au développement d'un hématozoaire du genre Plasmodium Garnham, 1966dont 4 espèces infectent l'homme (Carter, 1998). Ce protozoaire sanguicole esttransmis à l'homme par piqûresinfectantes de femelles des moustiques du genre Anopheles Meigen, 1918dont ondénombre près de 3500 espèces reparties à travers le monde (Eldrige, 2005). Ces Culicidés constituent l'un des groupes de vecteurs les plus importants en santé publique :ils sont impliqués dans la transmission de plusieurs autres infections telles que la fièvre jaune, la dengue, les filarioses lymphatiques... (Rodhain, 1999).

La mise au point d'un vaccin efficace contre le paludisme a été envisagée depuis de nombreuses années, mais les recherches ont été rapidement entravées du fait de la grande variabilité génétique de P. falciparumWelch, 1897et de son fort polymorphisme (Farooq et Mahajan, 2004; Smith et Milligan, 2005). Par conséquent, la lutte contre cette parasitose repose essentiellement sur deux méthodes : l'une, préventive, par la mise en place des opérations de lutte antivectorielle et de protection contre les vecteurs, et l'autre curative, par la prise en charge des cas, ce qui suppose le diagnostic précoce et l'administration d'antipaludéensefficaces. Les différentes méthodes de lutte développées jusqu'ici contre la maladie se heurtent aux phénomènes de résistance de plus en plus fréquents, d'une part chez les plasmodiums vis-à-vis des antipaludéens et d'autre part chez les anophèles vis-à-vis des insecticides.

De ce point de vue, la connaissance des vecteurs et surtout de leurs structures génétiques est très importante pour la lutte antivectorielle qui représente un volet primordial dans le combat contre le paludisme. Il est donc important de connaître avec précision la biodiversité et la dynamique des populations de vecteurs afin d'optimiser les stratégies de lutte, en particulier dans les régions présentant des risques élevés d'épidémie. Ces régions potentiellement épidémiques se caractérisent parle niveau de stabilité/instabilité de la maladie, notions introduites par Mac Donald (1957). On définit ainsi :

- des zones de paludisme stable où la transmission est pérenne ou à fluctuation saisonnière mais dont les modalités sont stables au fil des annéeset le risque d'épidémie faible car le degré de prémunition de la population est élevé ;

- des zones de paludisme instable avec une modalité de la transmission variante dans le temps, par conséquent la population acquiert peu ou pas d'immunité et peut être sujette à des poussées épidémiques (Mouchet et al., 2004).

Parmi les zones présentant des risques d'épidémie palustre, on peut citer les régions de haute altitudequi à cause de la topographie composée de collineset de plateaux, présentent un environnement peu propice au développement des vecteurs et des parasites (Minakawa et al., 2002). Depuis les années 1920, des épidémies palustres ont été périodiquement déclarées en hautes altitudes en Afrique de l'est (Garnham 1945, Fontaine et al., 1978). En 1991, les premières résurgencesde paludisme ont été observées dans les plateaux centraux du Burundi, auparavant indemnes et, en octobre 2000, une grande épidémie y a été observée avec 3 millions de cas, dont 10 à 15% de morts (Aubry, 2007).Dans les hautes terres de l'est du Kenya, les résurgences du paludisme ont augmenté de fréquence et d'intensité au cours des 15 dernières années, contrairement aux années 1980 (Githeko and Ndegwa 2001, Zhou et al., 2004). Au Cameroun, aucune épidémie palustre n'a encore été déclarée. Cependant, Lindsay et Martens (1998) ont déclaré que les hautes terres africaines doivent être reconnues comme des régions sensibles si l'on considère l'effet possible du réchauffement climatique sur la transmission palustre (Ndenga et al., 2006). C'est dans cette optique que nous nous sommes proposé d'étudier la situation du paludisme d'altitude dans les hautes terres Ouest Camerounaises.

Notre travail consistera à :

· caractériser spécifiquement et comparer en fonction de l'altitude les populations de vecteurs du paludismede part et d'autre de la falaise des Mbô,

· étudierleniveaude transmissiondu paludisme dans cette zone de l'Ouest Cameroun et en déduire l'impact de la variation d'altitude.

Chapitre 1

Chapitre 1 :GENERALITES.

1.1.LE PALUDISME

1.1.1.Historique du paludisme

Originellement appelé Malaria, nom tiré de l'italien mal-aria ou "mauvais air",le mot paludisme tire son étymologie du latin palus signifiant marais car, dans le passé, le paludisme était fréquent dans les marais Pontins autour de Rome où il était aussi connu sous le nom de "fièvre romaine". C'est une maladie très ancienne,la première trace du paludisme étant la présence d'ADN de Plasmodium falciparum chez les momies datant de 3200 avant Jésus Christ (Miller 1958). Cette maladie est probablement originaire d'Afrique et a suivi les migrations humaines vers les côtes de la Méditerranée, jusqu'enInde et en Asie du Sud-est.Elle a sévi en Europe du sud et sur le pourtour de la méditerranée jusqu'au début du XXe siècle mais elle y a été éradiquée grâce à la disparition des vecteurs suite aux efforts de démoustication et à l'élévation du niveau de vie. Hippocrate, parlant de "fièvre atrabilaire" (en référence à la bile noire), a donné une description extrêmement précise de l'accès fébrile et de sa périodicité. C'est la quinine qui à partir de 1663 fera l'unanimité pour la combattre (Wéry, 1995) mais de nos jours, suite au développement de résistances contre les antimalariques par les parasites, de nouvelles molécules ont été créées. Selon les estimations actuelles, 49 de la population mondiale vit sous la menace du paludisme. Il tue plus d'un million de personnes chaque année. On estime que 3,2 milliards d'êtres humains vivant dans 107 pays et territoires, sont confrontés à ce risque (O.M.S, 2005).

1.1.2.La transmission du paludisme

L'infection palustre correspond à l'inoculation du parasite à un organisme. Quatre modes de transmission du paludisme à l'homme sont possibles (Mouchet et Carnevale, 1991) :

- la transmission par piqûre infectante d'un anophèle ;

- la transmission par voie transplacentaire, responsable du paludisme congénital ;

- la transmission par transfusion sanguine (plus rarement de nos jours) ;

- la transmission accidentelle par des instruments infectés.

Le facteur limitant de la distribution du paludisme dans le monde concerne la transmission du parasite d'homme à homme, c'est-à-dire par les vecteurs (Mouchet et al., 2004). L'introduction d'un sujet porteur duparasitedans une région où il n'y a pas de vecteurs pour assumer la transmission aboutit à une impasse parasitaire. L'homme sert d'hôte vertébré intermédiaire, d'amplificateur et de victime mais à lui seul, il ne peut pas entretenir la maladie.

Pour qu'un anophèle soit un bon vecteur de plasmodiums humains, il doit présenter :

- une compatibilité génétique vecteur/parasites, permettant la tolérance du parasite,

- une longévité du vecteur supérieure à la durée du cycle extrinsèque du parasite,

- l'anthropophilie et l'endophiliedu vecteur (Mouchet et Carnevale, 1991).

1.1.3.La maladie

Le paludisme se caractérise principalement par des périodes d'accès de fièvre ou accès palustres. L'infection palustre présente trois stades d'évolution :

- une phase d'incubation après la piqûre infectante ; elle correspond au développement des schizontes dans le foie. Elle est généralement asymptomatique,

- une phase d'invasion avec fièvre parfois accompagnée de céphalées et parfois de myalgies et d'hépatomégalie,

- une phase d'état avec fièvre intermittente, pendant la schizogonie érythrocytaire. La fièvre est rythmée et due à l'éclatement des schizontes mûrs et au déversement dans le sang de l'hypnozoïne qui est un pigment pyrogène.

Chacun des agents pathogènes présente des particularités quant aux symptômes et à la périodicité des accès. En absence de traitement efficace, on peut subir des fièvres tierces ayant une périodicité de 48 heures (P. falciparum, P. vivax, P. ovale) et des fièvres quartes ayant une périodicité de 72 heures (P. malariae). L'usage d'antipaludiques adéquats permet d'interrompre l'évolution de l'infection.En cas de non traitement ou d'échec thérapeutique, des complications peuvent survenir : on peut aboutir à une fièvre bilieuse avec hémoglobinurie, des atteintes cérébrales, des mortalités foeto-maternelles chez la femme enceinte ou la mort du malade.

1.2.LES AGENTS PATHOGENES

1.2.1.Position systématique des Plasmodiums

Les agents responsables du paludisme sont des parasites hématophages du genre Plasmodiumdécouverts en 1880 par Laveran(Mouchet et al., 2004).La position systématique de ce parasite est la suivante :


Embranchement : Protozoaires
Sous-embranchement : Apicomplexa
Classe : Sporozoaire
Ordre : Coccidiomorphes
Sous-ordre : Haemosporidae
Famille : Plasmodiidae

Genre : PlasmodiumGarnham, 1966

La famille des Plasmodiidae réduite au seul genre PlasmodiumGarnham, 1966a été subdivisée en 10 sous-genres en fonction de leurs hôtes : trois sont parasites de mammifères, quatre parasites d'oiseaux et les trois autres parasites de reptiles. Tous les parasites de mammifères sont transmis par des anophèles.

1.2.2.Les Plasmodiums humains

Quatre espèces de plasmodiums sont responsables des infections palustres humaines.Ces plasmodiums humains diffèrent entre eux par plusieurs caractéristiques épidémiologiques, biologiques et cliniques spécifiques(Mouchet et al., 2004). Ce sont :

P. falciparumWelch, 1897 est l'espèce la plus répandue. Elle est présente chez 80% à 90% des sujets parasités. Cette espèce est fortement implantée en Afrique tropicale et y sévit de façon permanente, avec des recrudescences durant les saisons pluvieuses favorisant la pullulation des vecteurs. Sa durée d'incubation est de 7 à 15 jours et sa longévité inférieure à un an. Elle est à l'origine de la fièvre tierce maligne, la plus meurtrière. C'est un parasite d'hématies de tous les âges, la schizogonie érythrocytaire se faisant dans les organes profonds. En cas de complications le stade de neuropaludisme peut être atteint.

P. malariaeLaveran, 1881se rencontre dans toute la région Afro-tropicale à des fréquences très variables, de 2% à 45%. Elle est généralement plus fréquente dans les zones forestières. Elle est à l'origine de la fièvre quarte bénigne à recrudescence tardive. Sa longévité est d'environ 21 jours et elle s'attaque principalement aux hématies vieilles. Sa recrudescence peut aller jusqu'à 10 à 20 ans, par réactivation de formes érythrocytaires latentes (pas d'hypnozoïtes).C'est la seule espèce commune à l'homme et aux animaux, plus précisément aux chimpanzés.

P. vivaxGrassi et Feletti, 1890 est répandue en zone équatoriale. Elle est responsable de la fièvre tierce bénigne, la plus répandue. Son incubation dure environ 15 jours et peut s'étendre jusqu'à 7 mois. C'est un parasite d'hématies jeunes et il ne peut pas s'attaquer aux sujets Duffy négatifs1(*) ; les Mélano-africains sont donc réfractaires à ce parasite. On peut observer des rechutes pendant une période de deux ans dues à l'existence d'hypnozoïtes.

P. ovaleStephens, 1922a une localisation essentiellement africaine. Longtemps confondue à la précédente, elle remplace P. vivax chez les sujets Duffy négatifs. Elle cause une fièvre tierce bénigne. Sa longévité est de 15 jours et on note des rechutes pouvant durer 5 ans, dues à la présence d'hypnozoïtes hépatiques (Danis et Mouchet, 1991 ; Mouchet et al., 2004).

1.2.3.Cycle évolutif de Plasmodium falciparum

1.2.3.1.Chez l'hôte vertébré (homme)

L'homme est contaminé par piqûre infectante de l'anophèle femelle(figure 1). Les formes infectieuses (sporozoïtes) sont mobiles et contenues dans la salive du moustique (1). Les sporozoïtes sont injectés dans le tissu sous cutané, ils passent environ 45 minutes dans le sang et atteignent le foie. Chaque sporozoïte pénètre dans un hépatocyte et il devient une forme incapable de se déplacer qui sera obligatoirement endocellulaire. Le cycle se déroule ici en deux phases : une phase hépatique (exo-érythrocytaire) et une phase sanguine (endo-érythrocytaire). L'homme est considéré comme hôte intermédiaire car la phase sexuée du cycle du parasite se déroule chez le moustique.

Schizogonie hépatique ou exo-érythrocytaire

Un cycle de reproduction asexuée se déroule dans les hépatocytes parasités (2) : le sporozoïte se transforme en un trophozoïte endocytoplasmique qui grossit et dont le noyau se divise de nombreuses fois. Après une durée moyenne de 8 à 15 jours, le cytoplasme de l'hépatocyte est envahi par une masse contenant plusieurs milliers de noyaux qu'on appelle schizonte (3). L'hépatocyte parasité sera dilaté et ponctué de milliers de points bleus d'où son appellation de "corps bleu". A maturité, chaque noyau s'individualise avec un peu de cytoplasme du parasite pour donner plusieurs milliers de mérozoïtes (ou cryptozoïtes) ; l'hépatocyte parasité éclate (4) et les mérozoïtes libérés (5) pénètrent dans la circulation des capillaires le jouxtant, chacun va pénétrer dans une hématie.

La durée du cycle de reproduction asexuée dans l'hépatocyte est variable(8 à 15 jours) suivant les espèces. Le processus de reproduction se déclenche immédiatement dans tous les hépatocytes parasités pour les espèces P. malariae et P. falciparum. Ce processus peut être retardé dans certains hépatocytes qui restent en attente (d'où leur nom d'hypnozoïtes), pour une durée allant de 1 à 18 mois chez les espèces P. vivax et P. ovale.

Schizogonie érythrocytaire ou endo-érythrocytaire

Dans chaque hématie envahie par un mérozoïte (6) va se dérouler un cycle de reproduction asexuée. Il se consiste en un passage par les formes trophozoïte jeune (forme en anneau), trophozoïte âgé (forme amoeboïde) (7), schizonte jeune (nombre variable de noyaux) puis schizonte mûr à nombre de noyaux défini (8). Les schizontes se chargent de pigment malarique ou hémozoïne. Chaque noyau s'entoure d'une portion de cytoplasme et forme un schizonte mûr ou corps en rosace (9). La durée du cycle et le nombre de mérozoïtes obtenus sont caractéristiques de chaque espèce.

A l'issue de chaque cycle, les hématies parasitées éclatent de façon généralement synchrone (10) et les mérozoïtes libérés envahissent des hématies saines ; plusieurs cycles se succèdent. Après environ une semaine, certains mérozoïtes vont se distinguer en commençant le cycle sexué du parasite; les uns vont devenir des gamétocytes mâles, les autres vont devenir des gamétocytes femelles (11). Les gamétocytes restent en attente dans leurs hématies ; la durée de vie des gamétocytes est de quelques jours mais de nouveaux gamétocytes sont produits à la fin de chaque schizogonie érythrocytaire. La morphologie et les affinités tinctoriales de toutes les formes érythrocytaires sont caractéristiques de chaque espèce et servent à son identification lors du diagnostic microscopique.

1.2.3.2.Chez l'hôte invertébré (moustique vecteur)

Au cours de la piqûre, l'anophèle ingèredes hématies parasitéeschez un sujet malade.Seuls les gamétocytes (formes sexuées) évolueront et deviendrons des trophozoïtes.

Dans l'estomac de l'anophèle, les gamétocytes mâles subissent l'exflagellation et donnent des gamètes mâles mobiles. Chaque gamétocyte femelle mûrît pour donner un gamète femelle volumineux, arrondi et immobile. La fécondation de chaque gamète femelle par un gamète mâle (12) donne autant de zygotes appelés ookinètes (13) d'aspect vermiforme (10 um x 3 - 4 um). Les ookinètes s'insinuent entre les cellules de la paroi stomacale du moustique (14) et vont se localiser à la face externe de l'estomac où ils deviennent des oocystes (15,16). La durée totale entre le repas contaminant du moustique et la sortie des ookinètes est de l'ordre de 24 heures.

À l'intérieur de l'oocyste vont se former des sporocystesqui donneront plusieurs centaines de sporozoïtes (16). L'oocyste est sphérique et sa taille passe d'environ 8um à environ 60 à 80um pendant sa maturation. La maturation de l'oocyste (ou sporogonie) dure de 4 à 21 jours suivant les conditions climatiques pour P. falciparum. A maturité les oocystes éclatent et les sporozoïtes sont libérés dans l'hémolymphe (17).En 24 heures environ, la majorité d'entre eux va se concentrer dans les glandes salivaires (18). L'anophèle sera infectieuse, en fonction des conditions climatiques, 8 à 21 jours après le repas sanguin contaminant et le restera au maximum deux mois (Mouchet et al., 2004). Etant le siège de la phase sexuée du cycle, le moustique est considéré comme étant l'hôte définitif du parasite.

Adapté de :http :// ebischoff.free.fr/Paluz.html

Figure 1 :Cycle de développement du Plasmodium chez l'Homme et l'Anophèle vecteur

1.3.LES VECTEURS

1.3.1.Position systématique des anophèles

D'après Harbach (2004),les anophèles se positionnent d'un point de vue systématique comme suit :

Règne : Animal

Embranchement : Arthropodes

Sous-embranchement : Antennates

Classe : Insectes

Section : Oligonéoptères

Super-ordre : Mécoptéroïdes

Ordre : Diptères

Sous-ordre : Nématocères

Famille : Culicidae

Sous-famille : Anophelinae

Genre : AnophelesMeigen, 1918.

1.3.2.Généralités

Les moustiquesconstituent parmi les diptères nématocères la famille des Culicidae ou Culicidés. Cette famille est composée d'environ 3450 espèces et sous-espèces appartenant à 38 genres (Graham et al., 1995).Les moustiques sont repartis dans le monde entier et principalement au niveau de la ceinture équatoriale ainsi qu'une partie de la zone tempérée où les températures sont assez chaudes. On les retrouve jusqu'à 5500 m d'altitude dans certaines régions et aussi à 1250 m sous le niveau de la mer dans des mines (Service, 1993). Ce sont des insectes mesurant en moyenne 3 à 8mm de long, certaines espèces pouvant atteindre 19mm de long.

Les Culicidaesont divisés en trois sous-familles et 37genres : Toxorhynchitinae (1genre),Culicinae (33genres) et Anophelinae (3genres). La différenciation entre genres se fait suivant des critères taxonomiques (figure 2). Certaines différences sont visibles même dès les stades larvaires(Danis et Mouchet, 1991).

Sur plus de 500 espèces d'anophèles connues, environ70 peuvent assurer la transmission du paludisme mais juste une vingtaine sont considérées comme vecteurs majeurs du paludisme, les autres jouant un rôle secondaire de manière localisée (Mouchet et al., 2004). La faune anophélienne d'Afrique comporte 145 espèces d'anophèles dont 16 sont impliquées dans la transmission du paludisme à l'homme. Cinq vecteurs sont d'importance majeure : An. gambiae s.s., An. funestuslargement répandus, An. moucheti et An. nili présents dans les régions forestières et An. arabiensis présent en zones de savanes (Gillies et De Meillon, 1968 ; Antonio-Nkondjio etal., 2006). A ceux-ci s'ajoutent d'autres espèces plus ou moins localisées.

Source : Lane &Croskey,1993 .

Figure 2 : Comparaison des principaux genres de Culicidés.

1.3.3.Cycle de vie des Anophèles

Les Culicidés ont un mode de développement de type holométabole (à métamorphose complète), les larves ayant une morphologie et un mode de vie très différents de ceux des adultes : les stades pré-imaginaux sont aquatiques alors que les adultes sont aériens. Le cycle de vie présente quatre stades évolutifs : l'oeuf, les larves, la nymphe et l'adulte (figure 3).

1.3.3.1.Les oeufs

En fonction des espèces, les femelles de moustiques pondent 30 à 300 oeufs par cycle gonotrophique. Les oeufs d'anophèles mesurent 0,6 à 0,8 mm de long. Incurvés et munis de flotteurs latéraux remplis d'air, ils sont déposés à la surface de l'eau au moment de la ponte. Ces oeufs ne supportent généralement pas la dessiccation mais ceux de certains moustiques à l'exemple de Aedes haemagogus et Ae. albopictus ont un chorion étancheleur permettant de supporter la dessiccation durant plusieurs semaines (Rodhain, 1999). L'éclosion a lieu en général au bout de 36 à 48h mais il arrive que sur la boue humide ou en eau très froide elle soit différée de quelques jours (Danis et Mouchet, 1991).

1.3.3.3.Les larves

Les larves de moustiques se distinguent de celles des autres insectes par l'absence d'appendices locomoteurs et la forme du thorax (bulbeux, plus large que la tête et l'abdomen)(Service, 1995). Leur abdomen porte des plaques dorsales sclérifiées et des soies palmées caractéristiques des anophèles.Ces soies contribuent au maintien de la larve juste sous la surface de l'eau, dans une position typique aux anophèles : parallèle à la surface, face dorsale vers le haut. Ces larves sont recouvertes d'un tégument rigide et inextensible composé de sclérotine et de chitine qui leur impose une croissance par mues. Les larves respirent l'air atmosphérique grâce à leurs spiracles dorsaux. Elles sont détritivores, se nourrissant d'éléments planctoniques comme les levures, les bactéries, les protozoaires... La durée totale dela vie larvaire est d'environ 8 à 12 jours(Danis et Mouchet, 1991).Il existe quatre stades larvaires,la nymphose (dernière mue) transforme la larve du quatrième stade en une nymphe.

1.3.3.3. Les nymphes

Elles ont une forme en virgule, la tête et le thorax étant fusionnés pour former le céphalothorax. Elles possèdent deux trompes respiratoires situées dorsalement sur le céphalothorax et leur permettant de respirer l'air atmosphérique. L'abdomen comporte huitsegments bien visibles et leur contraction brusque permet le déplacement des nymphes. Elles ne se nourrissent pas pendant toute la durée du stade et subissent à la fin un remaniement important. Ces transformations morphologiques et physiologiques marquent le passage du stade nymphal au stade adulte. L'émergence dure environ 15 min et, en élevage, on a constaté que les larves mâlesémergent en moyenne 24 heures avant les larves femelles (émergence protandrique) (Rodhain et Perez, 1985).

1.3.3.4. Les adultes

L'adulte présente trois parties bien distinctes : tête, thorax et abdomen. Après l'émergence, ces insectes doivent se reposer pendant 12 à 24 heures pour que leur exosquelette se durcisse et que les organes se mettent en place. L'adulte ou imago a une biologie orientée principalement vers la fonction de reproduction, ce qui nécessite une nutrition appropriée. Ces adultes prennent un premier repas de sève de plante ou de jus sucré sur le nectar des fleurs pour satisfaire leurs besoins énergétiques.On peut distinguer le cas des mâles de celui des femelles quant à leur éthologie et leur écophysiologie :

- Les moustiques mâles ont les antennes plumeuses qui ont un rôle olfactif intervenant dans la recherche des femelles. Ce caractère permet de distinguer à l'oeil nu les deux sexes. Ils ne sont pas hématophages et, de ce fait, ils ne se déplacent pas loin de leurs gîtes. Leur longévité est relativement faible : une semaine à 10 jours(Rodhain et Perez, 1985).Apres le troisième jour, les mâles essaiment au crépuscule puis s'accouplent (Danis et Mouchet, 1991).

- Les femelles ont des antennes glabres et ne s'accouplent le plus souvent qu'une seule fois dans la vie (Cléments, 1992). Contrairement aux mâles, elles sont hématophages et se nourrissent,en plus du jus de plantes, du sang d'animauxvertébrés qu'elles prélèvent par piqûres. On parle aussi de gorgement (figures 4 a et b). Les substancesalimentaires résultant de la digestion du sang absorbé sont utilisées en partie pour la nutrition, la régulation thermique, mais surtout pour la maturation des oeufs. Les femelles ont une durée de vie de troissemaines à trois mois, parfois beaucoup plus (Rodhain, 1999).Les bons vecteurs du paludisme se caractérisent par une longévité supérieure à deux semaines, durée nécessaire à leur développement et à l'exécution du cycle extrinsèque du parasite.

1.3.4.Les principaux vecteurs du paludisme au Cameroun

Au Cameroun, cinq espèces sont considérées comme vecteurs majeurs du paludisme. Il s'agit d'An. gambiae s.s., An. arabiensis,An. funestus,An. nili etAn. moucheti (Njan Nloga etal., 1993; Fontenille et Simard, 2004). D'autres espèces telles que An. paludis, An. pharoensis, An. hancocki, sont considérés comme des vecteurs d'importance locale car présents juste dans quelques régions (Fontenille etal., 2000; Antonio-Nkondjio etal., 2006). A ceux-ci s'ajoute An. ovengensis, découverte récemment au Sud Cameroun (Awono-Ambene etal., 2004).

Adapté de : Mouchet et Carnevale 1991

Figure 3 :Cycle biologique des Anophèles

b

a

Source : http://www.infoscience.fr/dossier/moustique/moustique_som.html

Figures 4 (a et b) :Anophèle femelle à jeun (a) et Anophèle femelle gorgée (b)

1.3.4.1. Le complexe Anopheles gambiae

Initialement considéré comme étant une seule espèce, An. gambiae s.l.est actuellement reconnu par tous les biologistes comme étant un complexe d'espèces. Il regroupe en son sein sept espèces bien définies dont la découverte a commencé lors d'études sur la transmission de gènes de résistance aux insecticides (Davidson, 1962 ; 1964) et dont les croisements produisent des mâles stériles (White 1985 ; Hunt et al., 1998).Ce sont :

- An. arabiensis Patton, 1904

- An. bwambae White, 1985

- An. gambiae sensu strictoGiles, 1902

- An. melasTheobald, 1903

- An. merus Doenitz, 1902

- An.quadriannulatus A Theobald, 1911

- An.quadriannulatus BHunt et al., 1998 (Mouchet et al.,2004).

Les espèces de ce complexe sont présentes dans les régions de forêt dégradées ou de savanes humides et occupent ainsi toute la ceinture équatoriale africaine.Au Cameroun, on les retrouve dans toutes les régions (Fontenille et al., 2000, Wondji et al., 2005).Les travaux de cytogénétique de Colluzi et al., (1979) ont permis de montrer que ces espèces sont génétiquement distinctes et caractérisées par des inversions chromosomiques stables associées à des adaptations aux conditions climatiques (aridité, température...).

Considérée comme « un des meilleurs, sinon le meilleur vecteur du monde » (Mouchet et al., 2004), An. gambiae s.s. est l'espèce la plus répandue de la planète. Les larves se développent dans les collections d'eau claires, peu profondes, ensoleillées et sans végétation. Ce sont par exemple des empreintes de pas, des traces de pneus de voitures, des flaques ou des rizières irriguées. Il a ainsi été démontré par Muirhead-Thompson (1945) en Sierra Leone que si l'on mettait de l'ombre sur un gîte de ponte, il n'était plus utilisé par les femelles de An. gambiae (Mouchet et al., 2004).Au sein de l'espèceAn. gambiae s.s., des travaux de biologie moléculaire ont permis d'identifier deux formes moléculaires : M et S (Della-Torréet al., 2000). Elles sont associées aux différentes formes chromosomiques de cette espèce et présentent probablement un isolement reproductif. En effet, aucun hybride M/S n'a été retrouvé dans la nature tant en Côte d'ivoire (Chandre et al., 1999)qu'au Burkina (Della-Torréet al., 2005) et au Cameroun (Wondji et al., 2005).C'est une espèce très anthropophile, avec des indices sporozoïtiques en général supérieurs à 3%. En journée, ces insectes se posent dans des gîtes de repos qui peuvent être soit des habitations (endophilie), soit sous des abris extérieurs (exophilie) tel que les arbres et arbustes, les hangars ouverts...

1.3.4.2. Legroupe Anopheles funestus

Ce groupe comprend 9 espèces difficiles à différencier morphologiquement(Gillies et de Meillon, 1968 ; Gillies et Coetzee, 1987). Ces espèces sont assez mal connues et ne peuvent être différenciées que par de très discrets caractères sur les larves ou les adultes(Fontenille et al., 2003). An. leesoni, An. confusus, An. fuscivenosus, An. rivulorumetAn brucei sont identifiables au stade larvaire alors que les espèces du sous-groupe funestus : An. funestus s.s.(vecteur à capacité vectorielle assez élevée), An. parensis, An. vaneedeni et An. aruni peuvent être identifiées par de petites différences morphologiques chez les adultes (Gillies et Coetzee, 1987).

Les espèces de ce groupe sont essentiellement zoophiles, à l'exception de An. funestuss.s.(seule espèce chez qui des plasmodiums humains ont été retrouvés), et très rarement An. rivulorum en Tanzanie (Wilkes et al., 1996).

1.3.4.3. Le groupeAnophelesmoucheti

Anopheles moucheti est un vecteur important du paludisme dans les localités situées le long des cours d'eau à courant lent en Afrique équatoriale. Il est largement présent dans le massif forestier centrafricain, du Cameroun à l'Ouganda. Les formes pré-imaginales se développent dans les cours d'eau à faible courant et riches en débris végétaux (Fontenille et al., 2003). Les études effectuées dans le groupe An. moucheti ont permis d'identifier 3 formes morphologiques :

- An. moucheti mouchetiEvans 1925, (forme typique)

- An. moucheti nigeriensisEvans 1931,

- An. moucheti bervoetsiD'Haenens 1961 (Gillies et De Meillon, 1968).

1.3.4.4. Le groupe Anopheles nili

Il est largement répandu en Afrique tropicale (Kamau et al., 2002) etest un vecteur important de plasmodiums dans certaines zones rurales forestières en Afrique centrale. Les larves de An. nili se développent aux abords des rivières et des fleuves abritant de la végétation. Plusieurs auteurs ont suggéré que An. nili est un groupe d'espèces (Carnevale et al., 1992;Brunhes et al., 1999). Sur la base de critères morphologiques, quatre espèces ont été décrites :

- An. nili s.s.

- An. somalicus

- An. carnevalei signalé au Cameroun et en Côte d'ivoire (Brunhes et al., 1999)

- An. ovengensisrécemment décrite au Sud Cameroun (Awono-Ambene et al., 2004).

Très rarement capturé au repos à l'intérieur des habitations, An. ovengensis serait plutôt exophile tout comme An. somalicus, contrairement aux 2 autres qui sont endophiles (Awono-Ambene et al., 2004).

1.4. TECHNIQUES D'ECHANTILLONNAGEDES CULICIDES

1.4.1. Collecte des stades pré-imaginaux

La méthode de collecte utilisée est celle du «dipping» (Service, 1993). Elle consiste à prélever l'eau du gîte à l'aide d'une louche ou d'un petit bac, puis y rechercherles larves de moustiques. Ces larves sont alors collectées et conservées dans des bocaux contenant de l'eau provenant de leurs gîtes respectifs (lorsque les conditions précises d'élevage ne sont pas connues) jusqu'à l'émergence.

1.4.2. Récolte des moustiques endophiles (faune résiduelle)

Cette méthode de collecte fournit des spécimens vivants pouvant permettre la réalisation des tests de sensibilité et essais biologiques tel que des observations sur la mortalité des moustiques dans les maisons traitées par un insecticide ou avec des moustiquaires imprégnées. Elle permet aussi de faire des mesures quantitatives parmi lesquelles :

- la diversité spécifique des moustiques endophiles(se reposant à l'intérieur des habitations),

-la mesure des densités d'endophilie de chaque espèce,

-les changements saisonniers dans la densité des moustiques se reposant à l'intérieur.

1.4.2.1. Récolte à l'aspirateur de moustiques endophiles

Cette technique consiste à attraper directement les moustiques au repos à l'aide d'un aspirateur. Ce type de récolte fournit des informations sur les lieux de repos habituels, les densités par habitation au repos et les variations saisonnières des densités.

1.4.2.2. Capture au pyrèthre de moustiques endophiles

Elle implique la pulvérisation spatiale d'insecticides à l'intérieur descases pour assommer les moustiques se reposant à l'intérieur et les ramasserensuite.Le choix de l'insecticide utilisé est très important car ce dernier doit agir assez rapidement pour ne pas laisser le temps aux moustiques de s'échapper et sans les endommager.

1.4.3. Capture des moustiques exophiles

Les données de collecte exophiles sont importantes pour évaluer l'impact de la lutte antivectorielle et fournir des informations sur les espèces se reposant habituellement à l'extérieur. Cette capture se pratique dans les lieux de repos naturels ou dans des abris spécialement aménagés à cette intention, abrisqui ont l'avantage de fournir des échantillonnages plus représentatifs pour un travail quantitatif. Les pièges à insectes sont le plus souvent utilisés ici.

1.4.4. Capture sur volontaires humains et sur appâts animaux

Cette technique consiste à capturer les moustiques au moment où ils se posent sur un vertébré pour le repas de sang. Elle permet d'étudier le niveau du contact homme/vecteur par l'estimation de paramètres entomologiques tels que le taux de piqûres (agressivité des vecteurs), le rapport d'endophagie ou d'exophagie du vecteur.Elle permet également d'avoir une idée sur :

-la composition spécifique de la faune anophélienne anthropophage ;

- la détermination des espèces localesvectrices du paludisme ;

- le rythme nycthéméral des différentes espèces ;

La capture sur homme permet d'obtenir directement "l'agressivité" des moustiques,toutes les autres méthodes de récolte ne fournissant que des données d'interprétation moins fiables. Le Goff et al., (1997) ont remarqué en zone forestière du sud Cameroun que les densités anophéliennes évaluées par homme-nuit ont été 1,6 fois plus élevées dans les captures directes que celles obtenues avec les moustiquaires pièges simples, celles-ci étant 4,7 fois plus élevées que celles obtenues avec la méthode de la double moustiquaire décrite par l'OMS (2003). Ainsi, malgré les reproches des comités d'éthique, cette technique reste nécessaire lors des premières enquêtes. Afin de pallier aux risques d'infection, tous les captureursreçoivent un traitement présomptif.

1.5. MESURE DES INDICES ENTOMOLOGIQUES ET EPIDEMIOLOGIQUES

L'estimation quantitative de la transmission se fait par un certain nombre d'indices mathématiques calculés à partir des données recueillies lors des enquêtes entomologiques.Les trois principaux paramètres qui interviennent dans les formules fondamentales de la transmission du paludisme sont : le taux d'inoculation entomologique, la capacité vectorielle et l'indice de stabilité (MacDonald, 1957 ;Garret-Jones et Shidrawi, 1969).

Le taux d'agressivité(ma)

Il permet d'établir un rapport entre le taux d'anthropophilie et la densité anophélienne. Il s'exprime en nombre de piqûres par homme par unité de temps. Il s'obtient en capturant les anophèles venant piquer l'homme et en divisant le nombre de moustiques collectés par le nombre de sujets utilisés, par unité de temps : piqûres par homme par heure (p/h/h) ou par nuit (p/h/n) (Boudin et al., 1998).

L'Indice sporozoïtique (Is)

C'est le pourcentage d'anophèles porteurs d'antigènes circumsporozoïtiques (Ag CSP). Les sporozoïtes s'observent directement à l'état frais au microscope optique après dissection des glandes salivaires des moustiques ou par la recherche de l'antigène circumsporozoïtique grâce à la technique ELISA. L'Is (obtenu par microscopie) peut ensuite être comparé à l'Indice circumsporozoïtique (Ics) obtenu par ELISA.

Taux d'inoculation entomologique (TIE ou he)

Il représente le nombre de piqûres infectantes que reçoit un homme pendant un intervalle de temps donné. C'est le produit du nombre de piqûre par homme par nuit (taux d'agressivitéma) par l'indice sporozoïtique (Is) (Hamad et al., 2002). heest exprimé en nombre de piqûres infectantes par homme et par an (pi/h/an). Cette valeur est un bon indicateur de l'intensité de la transmission dans un contexte de grande densité anophélienne (Beier et al., 1999). Cependant, il ne peut pas être considéré comme une mesure exacte de la transmission car toutes les piqûres d'anophèles infectées n'aboutissent pas toujours à des infections humaines.

Taux de parturité (Tp)

C'est le pourcentage de femellespares (ayant pondu au moins une fois ? nullipares). C'est un paramètre qui permet de quantifier la proportion de la population potentiellement infectante pendant une période donnée, sachant que seules les anophèles pares sont susceptibles d'être infectantes. Plus ce taux est élevé, plus la population est âgée et épidémiologiquementdangereuse

(Denitova, 1963)

Taux quotidien de survie (P)

Il peut être estimé à partir de la proportion entre le nombre de femelles nullipares et pares dans la mesure où la durée des cycles gonotrophiques2(*)(x) est liée au taux de parturité. Mouchet et Carnevale (1991)ont estimé le cycle gonotrophique de An. gambiaedans la région forestière du sud Cameroun à 2 à 3 jours.

(Davidson, 1954).

Dans nos calculs nous avons retenu x = 3 jrs à Santchou et 4 jrs à Dschang en nous basant sur les travaux de Tchuinkam (2007). Si le taux quotidien de survie est inférieur à 50% alors moins de 1% des Anophèles sont aptes à survivre durant 8 jours, durée nécessaire pour le développement complet du parasite. Pour P. falciparum (qui requiert 10 à 12 jrs au moins pour compléter son cycle extrinsèque) le taux minimum nécessaire est 65% (Bruce-Chwatt, 1980a).

Les indices de stabilité (St)

Les notions de stabilité et d'instabilité ont été introduites par MacDonald (1957) et ont permis d'identifier deux zones :

Les zones de paludisme stable présentent une transmission élevée, saisonnière ou étalée sur la majeure partie de l'année, identique d'une année à l'autre. Dans ces zones, les populations ont un certain degré de prémunition contre la maladie et il n'y a presque pas d'épidémies mais juste des pics saisonniers dus à la pullulation des vecteurs. Les personnes atteintes sont principalement les enfants de moins de 5 ans et les femmes enceintes.

Dans les régions de paludisme instable, la transmission est généralement faible et variante d'une année à l'autre. Le vecteur y est peu anthropophile, son espérance de vie est faible. La population acquiert peu ou pas d'immunité et de ce fait, les infections palustres se traduisenttrès souvent par des cas cliniques. Ces régions peuvent être sujettes à des poussées épidémiques. Toutes les classes d'âge sont affectées (Mouchet et al., 2004).

L'indice de stabilité prend en considération 2 facteurs principaux : l'espérance de vie (1/-lnP), et l'indice d'anthropophilie (a)

a = indice d'anthropophilie

p = taux quotidien de survie

(Mac Donald, 1957)

- Si St< 0,5 le paludisme est instable, pouvant provoquer des épidémies.

- Si 0,5 = St = 2,5 le paludisme est de stabilité intermédiaire.

- SiSt> 2,5 le paludisme est stable

La capacité vectorielle (CV)

avec : ma² = taux de piqure sur homme au carré

x = durée du cycle sporogonique du parasite

px/logep = espérance de vie infectante

Selon les régions et les saisons, les vecteurs du paludisme peuvent être plus ou moins efficaces. Les principaux paramètres permettant l'évaluation de la capacité vectorielle sont : l'aptitude du vecteur à s'infecter, son aptitude à assurer le développement du parasite et l'aptitude à le transmettre (Rodhain et Perez, 1985). La capacité vectorielle exprime à la fois le degré de coadaptation entre vecteur et parasite et le fonctionnement du système ainsi formé dans un environnement donné. Cette notion a été quantifiée par Mac Donald (1957) puis Garret-Jones (1964) et représente le nombre de nouvelles inoculations attendues par jour (Garret-Jones et Shidrawi, 1969).On la calcule en utilisant la formule ci-après :

1.6. LE CONTRÔLE DU PALUDISME

La lutte contre cetteendémie se fait suivant deux approches différentes :

-empêcher l'inoculation du parasite à l'hommeen éliminant les vecteurs ou en évitant leurs piqûres(lutte antivectorielle) ;

-bloquer ledéveloppement du parasite dans l'organisme de l'homme (prise en charge précoce des cas).

L'absence d'un vaccin efficace de nos jours fait de la lutte antivectorielle la principale méthode préventive contre le paludisme.

1.6.1. La lutte antivectorielle

La lutte antivectorielle vise principalement à réduire la transmission et par conséquent l'incidence du paludisme en agissant sur la population des vecteurs à ses différents stades de développement.

1.6.1.1. Lutte contre les stades larvaires

Elle consiste en premier àéliminerles conditions propices à la vie pré-imaginale : le drainage des marais et l'utilisation d'huile de naphte pour la destruction des larves sont des mesures anciennes de lutte antilarvaire (Gentilini et Nozais, 1991). A celles-ci il faut ajouter l'aménagement et l'assainissement de l'environnement, la destruction des petits réservoirs d'eau (les pneus de voitures, les boîtes de conserves, les bouteilles) et les petites flaques d'eau pouvant servir de gîtes larvaires.

En second lieux, on peut effectuer la lutte biologique qui passe par l'utilisation des entomopathogènes larvaires tel que Bacillus thuringiensis H14 et des poissons larvivores tels que Gambusia affinis en eaux claires et Poecilia reticulata (guppy) en eaux polluées. En Somalie l'utilisation de Oreochromis spilurus a donné des résultats encourageants (Mouchet et al., 2004).

La lutte chimique peut également être envisagée. Elle présente l'avantage d'être rapide et efficace mais pourrait avoir des effets secondaires peu appréciés. Les larvicides sont pour cela utilisés (Walker, 2002).

1.6.1.2. Lutte contre les adultes

Se protéger contre les piqûres de moustiques sert non seulement à éviter les nuisances mais également les infections. Parmi les moyens de lutte, onpeut citer :

Ø Les moustiquairesdont l'utilisation remonte aux temps des pharaons en Egypte, sur les bords du Nil (Bruce-Chwatt, 1980b). L'acceptation des moustiquaires par les populations est liée surtout aux nuisances culicidiennes ; celles-ci représentent l'élément motivant des populations, moins sensibles à l'évocation des risques du paludisme (Mouchet et al., 2004). Les moustiquaires imprégnées sont aujourd'hui considérées comme un moyen de protection durable, applicable à large échelle à toutes les tranches d'âge de la population, avec un succès épidémiologique confirmé, car utilisées correctement et maintenues en bon état, elles procurent une protection totale aux dormeurs.

Ø Les pulvérisations intradomiciliaires d'insecticidessont très efficaces si leur utilisation est adéquate. Pendant toute la période d'éradication du paludisme, les pulvérisations intradomiciliaires ont été à la base de la lutte antipaludique (Mouchet et al., 2004).L'efficacité de cette technique dépend du lieu de repos des vecteurs. En région d'altitude, ces derniers deviennent très endophiles pour se protéger du froid. Bien que l'aspect préventif de cette lutte ne soit souvent pas le souci majeur des populations, elle contribue de façon non négligeable à la réduction de la transmission du parasite car les insecticides de contact réduisent non seulement la densité, mais aussi la longévité des anophèles.

Ø L'utilisation de produits répulsifs ouinsectifugesqui sont des substances chimiques visant à repousser les insectes ou à les empêcher d'attaquer l'homme et les animaux. Ils provoquent chez l'insecte une altération de la conduite de repérage de l'hôte, aboutissant à une déviation du vol, l'éloignant de sa cible(Combemale, 2001). Le choix d'un répulsif est difficile car il n'existe pas de molécule universellement active pour éloigner les moustiques. Les répulsifs couramment utilisés sont soitd'origine naturelle surtout les huiles essentielles, l'essence de citronnelle en Europe, soit de synthèse avec le diméthylphtalate, l'éthylexanediol, le diéthyltoluamide (DEET) insectifuge de référence ou les nouvelles molécules le 35/35,la pipéridine, le baye repel ou KBR 3023 (Combemale, 2001). Des produits locaux ont souvent été utilisés : l'huile de palme en Guinée, la fumée de diverses essences, l'huile essentielle de Ceylan et de Javacontenant de la Citronella (Mouchet et al., 2004).

Ø Des techniques du génie génétique : dispersion de mâles stériles, modifications génétiques sur les vecteursetc. sont en cours de perfection ;cependant, les scientifiques craignent l'impact biologique et environnemental que ces méthodes peuvent avoir à long terme.

1.6.2. La prise en charge des malades

Le premier traitement efficace contre le paludisme fut découvert au 17ème siècle en Amérique du Sud : l'écorce du Quinquina. Par la suite, le principe actiffût isolé de cette écorce et reçu le nom de Quinine. Il existe de nos jours de nombreux produits de synthèse (Amino 4 quinoléines, Amino 8 quinoléines,Aminoalcools...)qui sont actifs sur différents stades du parasite. Le traitement en masse des sujets infectés est impossible car il existe plusieurs souches de parasites et, au sein de chaque souche, plusieurs capacités d'adaptation et de résistance. Le traitement des sujets en équilibre avec leur infection risque de diminuer leur immunité et d'en faire ensuite la cible d'une souche plus virulente et accentuer la chimiorésistance.

Il est donc nécessaire d'accentuer la prophylaxie individuelle avec un suivi de chaque malade et s'assurer de sa bonne guérison afin de limiter le développement des résistances. Les antimalariques sont choisis par les spécialistes en fonction des efficacités régionales.

1.7. HYPOTHESES ET OBJECTIFS DE L'ETUDE

La causalité complexe d'une épidémie de paludisme comporte une multitude de variables qui ne sont pas totalement indépendantes, en ce sens qu'elles s'associent généralement à un certain nombre d'ensembles qui une fois connus, peuvent être utiles pour prévoir l'évolution et l'impact probable des variables qui les composent et par voie de conséquence, pour savoir comment les maîtriser. Comme variable, la séparation des groupes d'individus d'une population dans des régions présentant des caractéristiques différentes entre autres, peut avoir des effets sur leur morphologie et leur physiologie. En général, chaque espèce se différencie de son groupe d'origine lorsqu'elle s'en trouve séparée par une barrière écologique. Les modifications sont alors dues aux adaptations des populations à leur microclimat. La présence d'une falaise forestière entre Dschang et Santchoucorrespondant àune variation brusque d'altitude avec des variations des conditions climatiques, pourrait avoir un effet sur la structure et la dynamique des vecteurs. Dans la suitedu travail, il s'agira de :

· Déterminer la composition spécifique des populations de vecteurs de part et d'autre de la falaise ;

· Comparer la composition des membres du complexeAn. gambiae dans la plaine et sur le plateau ;

· Déterminer le niveau d'infection des anophèles par les plasmodiums dans les deux sites altitudinaux ;

· Calculer les indices entomologiques de transmission et en déduire le niveau de stabilité du paludisme dans les deux zones d'étude.

Chapitre 2

Chapitre 2 :MATERIEL  ET  METHODES.

2.1. SITES D'ETUDE

Notre étude a été réalisée dans deux villes assez proches (22 Km à vol d'oiseau) dudépartement de la Menoua, province de l'Ouest, se caractérisant par une brusque variation d'altitude entre elles, variation due à la présence d'une grande falaise nommée "falaise des Mbô" d'une hauteur de 650m. Ce sont : Dschang (chef-lieu du département) situé à 1400m d'altitude et, au bas de la falaise, Santchou (arrondissement) situé à 750m d'altitude.

2.1.1. Dschang

C'est une ville située au sud-ouest du plateau Bamiléké, à 5°27' Nord et 10°04' Est, délimitée au sud par la falaise des Mbô et au nord-est par les monts Bamboutos. La population est composée d'autochtones, en majorité cultivateurs,et de nombreux étudiants. Cette localité se trouve en zone de climat tropical de montagnes. Sa végétation est de type savane arborisée, partiellement éclairée par des zones d'urbanisation. Les températures moyenne sont plutôt basses (18°C 6). La pluviométrie moyenne annuelle est de 1900 mm/anavec une humidité relative moyenne de 75%. Elle présente un faible réseau hydrographique et un lac de retenue qui, associé à la topographie de la région, offre de bons sites larvaires malgré le relief accidenté, comme indiqué par l'enquête transversale de Garde et al. (1991) et les travaux de Tchuinkam (2007).

Les différentes saisons existant dans cette localité sont :

· La saison sèchereprésentée par deux périodes :

- La petite saison sèche qui va de juin à juillet ;

- La grande saison sèche de décembre à mars ;

· La saison des pluies elle aussi représentée par deux périodes :

- La petite saison des pluies entre avril et mai ;

- La grande saison des pluies du mois d'août à celui de novembre (Brenghes et Eouzan, 1979).

La figure 5 donne la répartition des cases en fonction de la topographie et de l'urbanisation à Dschang. Elles sont reparties dans trois zones :

- La zone rurale où les populations sont moins concentrées, l'habitat est le plus souvent en briques de terre (non crépie), et l'accès aux services utilitaires (eau et électricité) est faible ;

- La zone suburbaine avec des constructions en brique de terre, en semi dur ou en dur ; la concentration humaine augmente ;

- La zone urbaine où les constructions sont pour la plupart en matériaux définitifs, le niveau de salubrité est meilleur que dans les autres zones et les gîtes larvaires sont pollués.

Site de capture

0 500m

500 km

Dschang

Santchou

Source : Département de Géographie, Université de Dschang

Figure 5 : Répartition des cases de captures à DschangTableau 1 : Localisation des sites de capture en fonction de l'urbanisation à Dschang

Degré d'Urbanisation  

 Quartiers

Zone Urbaine

Paidground, Nkeleng

Côte d'azur

Zone Suburbaine

Madagascar, Ngui Nord,

Foto, Mission catholique Est

Zone rurale

Mission catholique Nord,

Ngui Ouest

2.1.2. Santchou

Située à la frontière sud de la Menoua à 5°25' Nord et 10°10' Est, elle est limitée au sud par les chaînes montagneuses du Manengouba et au nord par une falaise la limitant de la région de Foréké, du côté de Dschang. C'est une zone relativement plane et inondée en saison de pluies et serpentée par la rivière Nkam. La végétation est constituée d'une savane arbustive avec quelques régions boisées isolées le long des ruisseaux. La température moyenne est de 25°C 3, l'humidité relative 80% et la pluviométrie moyenne annuelle 2200 mm/an.La répartition des saisons est semblable à celle de Dschang,soit quatre saisons par an (archives SEMRY).

L'approvisionnement en eau courante n'étant pas encore assuré, la population consomme l'eau des puits etforages, ce qui augmente la prévalence des maladies du péril fécal et réduit la santé publique et conséquemment la résistance individuelle au paludisme. Les gîtes larvaires sont constitués par les eaux de puits, des flaques d'eau, des eaux d'inondations et des rizicultures.

A Santchou (figure 6), les habitations choisies pour les captures nocturnes sont réparties en fonction du niveau d'urbanisation. Lecentre-ville de Santchou représente la zone urbaine et les cases y sont choisies en fonction de l'éloignement de l'axe routier (tableau 2).La zone suburbaine est représentée par les quartiers périphériques avec des habitations isolées et entourées de quelques bosquets etla zone rurale par un regroupement de cases situées dans les plantations au bas de la falaise.Les maisons de capture ont été choisies en fonction de la proximité des gîtes permanents ou temporaires et surtout, de la coopération des habitants.

Tableau 2 : Localisation des sites de capture en fonction de l'urbanisationdans la plaine

Degré d'Urbanisation

Quartiers

Zone urbaine

Cassalafarm, Madagascar et "Nouveau quartier"

Zone Suburbaine

Fombap

Zone rurale

Ntengué

Route Principale

Route secondaire

Cours d'eau

Piste

Courbe de niveau altitudinale

Source : CNC Yaoundé

Figure 6 :Carte de la région de la plaine des Mbô

2.2.COLLECTEDES MOUSTIQUES

Les descentes sur le terrain ont été faites une fois par saison afin d'avoir une diversité sur toute une année. Deux techniques de capture ont été utilisées :

2.2.1. La capture sur volontaires 

Pour ce faire, les aspects éthiques ont été pris en compte tout au long du processus de préparation de notre étude pour garantir aux "captureurs" et résidents des habitations retenues une juste information sur leur participation et leurs droits dont le respect est assuré pendant toute la période, ainsi que de leur libre consentement. Aussi, tous les volontairesont reçuaprès les captures un traitement présomptif à base d'une combinaison Amodiaquine-Artésunate.

La capture est faite de nuit car les anophèles ont une activité nocturne. Les "captureurs"étaient de jeunes hommes de 18 à 30 ans qui, après avoir été formés, collectaienteux-mêmes les moustiques dans leurs domiciles,certains à l'intérieur des habitations et d'autres à l'extérieur. Deux équipes étaient utilisées : la première travaillant de 18h à 01h et la seconde de 01h à 06h. Leur équipement était composé d'un réveil, de sacs marqués par tranches horaires,d'une torche à pilesetde tubes à hémolyse pour contenir les moustiques. Ils attrapaient les moustiques au moment de la piqûre à l'aide des tubes qu'ils bouchaient ensuite avec du coton. Ces tubes étaient numérotés en fonction des lieux de captures et des tranches horaires puis rangés au frais.

2.2.2. La capture par pulvérisation intra-domiciliaire d'insecticide 

Cette méthode encore appelée "Capture au pyrèthre*(*)" (WHO, 1975)permet de récolter les espèces endophiles et d'avoir des spécimens semi-gravides. Les pulvérisations étaient réalisées dans le maximum de domiciles entre 15h et 17h. A l'intérieur des chambres, des draps blancs étaient étalés sur toute la surface du sol (pour faciliter la visualisation) et les ouverturesétaient fermées. Après avoir mis à l'abri les aliments et ustensiles susceptibles, l'insecticide était pulvérisé. Après le knock-down*(*)* et la dissipation de l'insecticide, les moustiques assommésétaient ramassés et rangés dans des boîtes pour l'identification et les analyses ultérieures.

2.3. IDENTIFICATION DES MOUSTIQUES

L'identification des moustiques se fait en deux phases :

- l'identification morphologique est faite juste après les récoltes et permet de distinguer les différentes groupes ou complexes d'espèces ;

- l'identification moléculaire faite au laboratoire permet de discriminer les complexes d'espèces qui ne peuvent pas être différenciées morphologiquement.

2.3.1. Identification morphologique

L'identification morphologique des moustiques se faisait au courant de la nuit ou tôt le matin après les captures sous une loupe binoculaire (×40) en s'aidant des clés d'identification des anophèles de Gillies et De Meillon (1968) et Gillies et Coetzee(1987).Les moustiques appartenant au genre Anophelesétaient rangés dans des tubesde 1,5 ml contenant du sillicagel (déssicant) recouvert d'une couche de coton. Ces tubes numérotés étaient alors conservés dans une glacière contenant des "iceblocs" avant d'être rangés à -20°C.

2.3.3. Identification moléculaire

Les analyses approfondies sont effectuées au laboratoire de paludologie de l'OCEAC à Yaoundé. Les échantillons ramenés du terrain sont conservés au congélateur à -20°C. Après l'identification morphologique, ceux appartenant au complexe An. gambiaesont utilisés pour les analyses génétiques.

2.3.3.1. Identification des membres du complexeAn gambiae

Elle se fait par des analyses comparatives du matériel génétique des spécimens. La première partie du travail consiste à isoler ce matériel génétique (ADN), ensuite l'amplifiersuivant la technique de PCR(polymerase chain reaction), et enfin la migration de l'ADN amplifié sur gel d'agarose.

Extraction de l'ADN

Principe : La technique d'extraction est basée sur la notion de solubilité différentielle des molécules entre deux phases non miscibles. L'extraction se fait par la technique de précipitation par l'alcool décrite par Cornel et Collins (1996), sur deuxà trois pattes par moustique.

Protocole : Pour chaque échantillon, les pattes sont placées dans unmicrotube stérile de 1,5 ml contenant 50 ul de tampon de broyage(Annexe 1, Tableau A). A l'aide d'un broyeur à piles, les pattes sont entièrement macérées et le broyat est incubé pendant 30 min dans un bain sec à 65°C. On y ajoute ensuite 13ul d'acétate de potassium 8M et on homogénéise aussitôt la solution grâce à un Vortex. Ce mélange est ensuite incubé 30 min dans la glace pour précipiter les débris cellulaires, puis centrifugé à 1400 tours/min à 4°C pendant 15 min. Le surnageant est transféré dans un autre tube auquel on ajoute 200 ul d'éthanol 100% à -20°C et on laisse au repos à température ambiante pendant 5 min pour que l'ADN puisse précipiter au fond du tube.

Une nouvelle centrifugation à 14000 tours/min pendant 20 min permet la formation d'un culot d'ADN peu visible au fond du tube. Après avoir vidé l'éthanol, le culot est rincé avec 200 ml d'éthanol 70% et passé au séchoir sous vide (speed-vac). L'ADN ainsi isolé est reconstitué dans 100ul d'eau distillée stérile et laissé à 4°Cpendant au moins 12h.

Amplification de l'ADN

Principe : L'amplification des différents loci est faite suivant la technique de polymérisation en chaîne (PCR) de Scott et al., 1993. Elle consiste à utiliser des amorces qui s'hybrident à des sites complémentaires (séquences flanquâtes) situés de part et d'autre de la séquence d'ADN cible. Cela requiert la présence de composantes regroupées dans un "milieu réactionnel" (Tableau B, Annexe 1).

Protocole : Quatre amorces différentes ont été utilisées pour la réalisation de la PCR : une amorce universelle (UN) et trois spécifiques (GA, AR, et ML) dont la séquence, la taille attendue et la localisation sont présentées en annexe 2. L'amplification se déroule dans un thermocycleur (Applied Biosystems system 2700) selon le programme illustré en figure 6 en 3 étapes :

· la dénaturation de l'ADN à haute température (94°C) pour séparer les 2 brins de l'ADN

· l'hybridation des amorces spécifiques à une température propre au type d'amorce : 56°C,

· l'élongation des brins d'ADN néoformés par l'enzyme de polymérisation à 72°C.

Ces cycles se répètent 35 fois3(*) et le nombre de copies de la séquence choisie subit une augmentation exponentielle car chaque nouveau brin formé sert de matrice à la synthèse d'un autre brin. De manière théorique, le nombre final de copies devrait être de 2n (n étant le nombre de cycles), mais le rendement est plus faible en pratique. A la fin de la réplication, la température s'abaisse à 4°C pour éviter toute dénaturation de l'ADN.

94°C94°'30"

4°C8

56°C30"

72°C72°C 20"10'

35 cycles

Figure 7 :Programmation du thermocycleur pour la PCR complexe An. gambiae

Détermination des génotypes : migration électrophorétique

Principe : Les acides nucléiques sont des macromolécules polyanioniques, de charge négative en milieu basique. Placés dans un champ électrique, ils vont se déplacer vers l'anode, mais leurs charges respectives étant à peu près équivalentes, c'est leur masse moléculaire qui va déterminer la vitesse de migration entre les mailles du gel. Plus ils sont légers, plus ils migrerontvite. Le gel d'agarose permet la séparation de fragments de taille comprise entre 0,5 et 20 kb.

Préparation du gel : Pour un gel d'agarose à1,5%, nous mesurons un volume(V) de tampon TBE 1X (tris-borate-EDTA) correspondant à laplaque (moule) à utiliser (le choix d'une plaque est fonction du nombre de puits qu'elle comporte et donc du nombre d'échantillons à faire migrer). On y ajoute une masse d'agarose (m)proportionnelle à la concentration attendue :

L'ensemble est passé aux micro-ondes jusqu'à ébullition puis refroidi à 50° environet on y ajoute5ul de BET (bromure d'éthidium). Cette solution est coulée dans lemoule auquel on ajoute des peignes pour former les puits. Après la polymérisation à température ambiante (1h), les peignes sont retirés et la plaque est placée dans une cuve de migration remplie de TBE 1X.

Distribution et migration des échantillons :A l'aide d'une micropipette, des gouttelettes de 2ul de bleu de charge (bleu de bromophénol 0,25% + bleu de xylène cyanol 0,25% + sucrose 4% + ED) sont déposées sur un morceau de parafilm.Elles permettront de maintenir l'ADN au fond des puits et faire apparaître les bandes sous UV. Ensuite, 10ul de chaque échantillon d'ADN amplifié sont mélangés au bleu de charge puis déposés au fond de chaquepuits. A ces échantillons sont ajoutés les 3 témoins positifs (An. gambiae s.s., An. melaset An.arabiensis),le témoin négatif, ainsi que le marqueur de taille (5ul de 100bp ladder). La cuve est enfin branchée à un générateur de courant continu (100volts) pendant 1h30min.

Lecture et interprétation : Après migration, le gel est photographié sous lumière ultraviolette. Des bandes correspondant à l'ADN ayant migré sont visibles grâce à la fluorescence des molécules de BET fixées sur l'ADN. La correspondance avec les bandes des témoins positifs et celles du marqueur de taille permet de déterminer l'espèce (en fonction des tailles attendues).

2.3.3.2. Détermination des formes moléculaires de An. gambiae s.s.

Ø 5' ... GCG C ... 3'

3' ... C GCG ... 5'

Principe : L'endonucléase Hhal (Haemophilus haemoliticus),enzyme de restriction, digèreles moléculesd'ADN et entraine leur rupture au niveau des sitesderestriction présentéecomme suit :

Protocole : Les produits de l'amplification sont distribués (10ul) dans des microtubes de 0,2ml contenant 15ul du "Master MIX" préalablement préparé sur glace (Tableau C, Annexe 1). Cet ensemble est placé à l'étuve (37°C) pendant au moins 3h ou toute une nuit.

Après digestion, on fait migrer le produit sur un gel d'agarose à 2% avec des témoins positifs (An. gambiae M et S) et le marqueur de tailles. L'ensemble sera photographié sous UV. Les tailles attendues sont 727 pb pour la forme M et 475 pb pour la forme S.

2.4. DETERMINATION DE L'INFESTATION DES ANOPHELES

La mise en évidence de l'infestation des anophèles femelles par Plasmodium a été faite par la technique ELISA (Enzyme Linked ImmunoSorbent Assay) qui permet de détecter la protéine circumsporozoïte de Plasmodium (CSP) dans l'organisme des anophèles. La technique utilisée est celle de Burkot et al., (1984) améliorée par Wirtz et al., (1987).

Principe : Elle consiste à coupler la protéine CSP à un anticorps monoclonal de capture (ACm) anti-circumsporozoïte(anti-CSP) préalablement fixé sur la paroi des puits d'une plaque. Le complexe antigène-anticorps formé est ensuite révélé par un anticorps monoclonal anti-CSP couplé à la peroxydase (marqué). L'adjonction d'un substrat qui sera dégradé sous l'action de l'enzyme induit une réaction colorée visible et dont la densité optique sera mesurée par spectrophotométrie (figure 7).

Puits de la plaque

fixation

Ac

Ac : anticorps

Ag : antigène

Figure 8 :Schéma du principe de la technique "ELISA sandwich"

Protocole ELISA-CSP monospécifique : La tête et le thorax de chaque moustique sont coupés et placés dans des tubes numérotés. On y ajoute 20ul de Np40 (détergent qui facilite la destruction des tissuspar hydrolyse des protéines membranaires) et le tampon de broyage "Blocking Buffer" (BB) à raison de 2x190ul par tubes et on les broie. Ces broyats sont conservés pendant 1hà -20°C.

Chaque plaque ELISA (Plaque de Nunc à 96 puits) est sensibilisée à raison de 50ul d'ACm de capture par puits et laissée une nuità +4°C, ce qui permet l'adsorption de l'ACm sur les parois de la plaque. Le lendemain, les plaques sont vidées, puis sans les laver, 200ul de tampon BB sont mis dans chaque puits pour saturer les sites de fixation libres des ACm. Après 1h d'incubation à température ambiante, les plaques sont vidées de nouveau et 50ul du broyat de moustique sont ajoutésdans chaque puits. La colonne de négatifsne reçoit que du BB et pour les puits des témoins positifs, 50ul de protéine circumsporozoïtique de l'espèce (P. falciparum) sont utilisés (annexe 3).

Après 2h d'incubation les plaques sont vidées et lavées 2 fois au PBS/Tween20. Ensuite on ajoute une solution d'ACm conjugué à la peroxydase (50ul/puits) préparée 10 min à l'avance. Après 1h d'incubation à température ambiante, les plaques sont de nouveau vidées et lavées 4 fois au PBS/Tween 20. Le substrat préparé 5 min avant la fin de l'incubation est distribué à raison de 100ul/puits. Les plaques sont alors conservées 30 minutes à l'obscurité. La dégradation du substrat sous l'action de la peroxydase se traduit par une coloration bleue.

Cette réaction est stoppée en ajoutant 50ul d'acide sulfurique 4N par puits, ce qui change la coloration bleue en une coloration jaune. La lecture s'effectue au moyen d'un spectrophotomètre à 450 et 650 nm. L'intensité seuil des positifs est fixée à deux fois la moyenne des témoins négatifs. La composition des réactifs et les quantités utilisées sont présentées en annexe 4.

2.5. ANALYSE DES DONNEES

Toutes les données ont été cataloguées à l'aide du logiciel Excel version 2007 qui nous a également permis de faire les analyses statistiques (moyennes, fréquences...). Le test khi-deux (÷2) calculé avec le logiciel EPI INFO version 6 a été utilisé pour comparer les fréquences spécifiques et autres indices entomologiques obtenus dans chaque localité.

Chapitre 3

Chapitre 3 :RÉSULTATS  ET  DISCUSSION

3.1. LA FAUNE ANOPHELIENNE

3.1.1. Composition spécifique de la faune anophélienne

Durant les deux années de récoltes de spécimens, entre août 2004 et novembre 2006, un total de 5084 anophèles a été récolté. En plus de celles-ci nous avons obtenu un grand nombre de moustiques appartenant aux genres Culex et Aedes, mais celles-ci n'ont pas été prises en compte dans la présente étude. Au total, 11 espèces d'anophèles ont été répertoriées dans les deux sites.An. gambiae, An. funestuset An. paludissont les espèces les plus abondantes avec comme fréquences respectives 86,37%, 5,74%, et 4,29%. Les autres espèces ont présenté des fréquences relativement faibles, inférieures à 1,5% (Tableau 3).

3.1.2. Productivité des différentes techniques de capture

Cinquante une (51) nuits de capture, totalisant 264 hommes-nuits ont été réalisées à Santchou et 3424 anophèles reparties en 10 espèces ont été collectées. La capture au pyrèthre a représenté 17,23% de la densité totale et 3 espèces seulement y sont représentées : An. gambiae,An. funestus et An. nili. Au cours des captures nocturnes, les 10 espèces répertoriées ici ont été retrouvées et le rendement en nombre (0,82 soit 82,77%) a été la plus élevé.

A Dschang, 51 nuits de captures nocturnes, totalisant 288 hommes-nuits, ont été réalisées. Au terme de celles-ci, 1660 anophèles ont été capturés appartenant à 9 espèces. Anopheles gambiae s.l.. et An. funestus ont été les seules espèces capturées en journée, au repos dans les habitations (par pulvérisation) mais à des taux bien faibles : 6,80% pour An. gambiae s.l.. et 3,08% pour An. funestus. Ce qui donne au total 06,39% pour la capture diurne par pulvérisation contre 93,61% pour la capture nocturne.

La capture sur volontaires(CNV) a été la plus rentable avec 4387 anophèles capturés (86,31% du total)(figure 8). Elle a permis de recenser toutes les onze espèces citées plus haut. La capture par pulvérisation (CPI) a permis d'avoir 696 anophèles (13,69%) appartenant à 3 espèces. La différence de densité anophélienneentre les deux sites a été significative pources deux méthodes aussi bien pour les captures par pulvérisation (÷2 = 87,57 ; P < 0,005) que pour les captures sur hommes (÷2 = 8,02 ; P = 0,0046).

Capture par pulvérisation

Capture sur volontaires

Figure 9 :Densités des anophèles en fonction du mode de récolte des échantillons à Dschang et Santchou d'août 2004 à novembre 2006

Tableau 3 :Composition spécifique de la faune anophélienne de Dschang et Santchou d'août 2004 à novembre 2006

Espèce

 

Santchou

 

Dschang

 

Total(%)

 

CNV

CPI

 

CNV

CPI

 

An. coustani

 

3

0

 

3

0

 

6 (0,12)

An. funestus

 

120

42

 

126

4

 

292 (5,74)

An. gambiae

 

2347

545

 

1397

102

 

4391 (86,37)

An. hancocki

 

1

0

 

4

0

 

5 (0,10)

An. moucheti

 

0

0

 

6

0

 

6 (0,12)

An. namibiensis

 

26

0

 

0

0

 

26 (0,51)

An. nili

 

52

3

 

1

0

 

56 (1,10)

An. paludis

 

211

0

 

7

0

 

76 (4,29)

An. pharoensis

 

1

0

 

0

0

 

1 (0,02)

An. wellcomei

 

5

0

 

2

0

 

7 (0,14)

An. ziemanni

 

68

0

 

8

0

 

218 (1,49)

Sous-total(%)

 

2834 (82,77)

590 (17,23)

 

1554(93,61)

106(06,39)

 

5084

Total (%)

 

3424 (67,35)

 

1660 (32,65)

 

CNV : Capture nocturne sur hommes volontaires ; CPI : capture par pulvérisation d'insecticides 

Tableau 4 : Variations saisonnières de la faune anophélienne à Dschang et Santchou d'août 2004 à novembre 2006

Espèces

 

Saisonssèches (%)

 

Saisons des pluies(%)

 

Total (%)

An. coustani

 

4 (0,57)

 

2 (0,05)

 

6 (0,12)

An. funestus

 

97 (13,92)

 

195 (4,44)

 

292 (5,74)

An. gambiae

 

564 (80,92)

 

3827 (87,24)

 

4391 (86,37)

An. hancocki

 

1 (0,14)

 

4 (0,09)

 

5 (0,10)

An. moucheti

 

0 (0,00)

 

6 (0,14)

 

6 (0,12)

An. namibiensis

 

0 (0,00)

 

26 (0,59)

 

26 (0,51)

An. nili

 

21 (3,01)

 

35 (0,80)

 

56 (1,10)

An. paludis

 

1 (0,14)

 

217 (4,95)

 

76 (4,29)

An. pharoensis

 

1 (0,14)

 

0 (0,00)

 

1 (0,02)

An. wellcomei

 

4 (0,57)

 

3 (0,07)

 

7 (0,14)

An. ziemanni

 

4 (0,57)

 

72 (1,64)

 

218 (1,49)

Total

 

697(13,71)

 

4387(86,29)

 

5084 (100)

3.1.3. Variations saisonnières des populations anophéliennes

Les récoltes de spécimens ont été étalées pendant toutes les saisons de la région. La distribution des différentes populations entre les deux types de saisons n'est pas homogène (Tableau 4). Certaines espèces à l'instar de An. moucheti et An. namibiensis n'ont pas du tout été capturées en saison sèche. Ainsi, lepourcentagede la populationen saison sèche (13,71%)a été bien plus faible que celui de la saison des pluies (86,29%). Malgré une baisse de densité en saison sèche, An. funestus et An. nili montrent plutôt une augmentation importante de leur fréquence dans la population totale. An. pharoensis n'a été retrouvé qu'en saison sèche mais sa densité très faible (1 seul individu) rend ce résultat difficilement interprétable.

3.2. STRUCTURE DU COMPLEXE ANOPHELES GAMBIAE

3.2.1. Composition du complexe Anopheles gambiae

Le test "PCR complexe gambiae" effectué sur un total de 430 spécimens a révélé la présence d'une seule des 3 espèces du complexe présentes au Cameroun soitAn. gambiae s.s.(390pb)à Santchou comme à Dschang. La révélation sur gel d'agarose de quelques spécimens est illustrée par la figure 9.

3.2.2. Formes moléculaires de Anopheles gambiae s.s.

Sur un total de 312 An. gambiae s.s. testés, nous avons obtenu 309 résultats positifs, tous de forme moléculaire S avec un poids moléculaire de 475 pb après amplification,et 3 résultats négatifs. Aucun échantillon M (727 pb)n'a été retrouvé dans les deux sites. Le profil de migration est présenté enfigure 10.

3.3.VARIATIONS DE LA COMPOSITION SPECIFIQUE ET DES INDICES ENTOMOLOGIQUES AVEC L'ALTITUDE

3.3.1. Variation de la composition spécifique de la faune anophélienne

Les captures ont été plus productives dans la région de basse altitude (Santchou) avec 67,35% de l'effectif total, qu'en haute altitude (Dschang)avec 32,65% du total (Tableau 3).

A Santchou : L'espèce la plus abondante a été An. gambiaes.l.avec 84,46% de l'effectif (n = 2892individus), suivie de loin par An. paludisavec 6,16% (n = 211) et An. funestus avec 4,73% (n = 162).An. namibiensis, An. ziemanni et An. nili ont été plus rares avec des fréquences inférieures à 2%. Les autres An. coustani, An. hancocki, An. pharoensiset An. wellcomei ont été récoltés à raison de moins de 5 individus par espèce.

Sens de migration

Mt G G G G G G G G Tn Mt Ta Tg

Puits de dépôt

Bande d'ADN

Gel d'agarose

G : échantillon d'ADN de An. gambiae s.s. ;Mt : marqueur de tailles ; Ta : témoin

An. arabiensis (315pb) ; Tg : témoin An. gambiae (390pb) ; Tn : témoin négatif.

Figure 10 : Profil de migration des différents membres du complexe An. gambiae

Sens de migration

Mt Tn S S S S S S S S Mt Tm Ts

Mt : marqueur de tailles ; : échantillon d'ADN de forme moléculaire S ; Tm : témoin pour forme moléculaire M (727 pb) ; Tn : témoin négatif ; Ts : témoin pour forme moléculaire S (475 pb) 

Figure 11 :Profil de migration sur gel d'agarose des spécimens de forme moléculaire M et S de An. gambiae s.s.

A Dschang :An. gambiaes.l.est l'espèce la plus représentée avec 90,30%de l'effectif (n = 1499individus), suivie de Anopheles funestus,7,83% (n = 130). Toutes les autres espèces à savoir An. coustani, An. hancocki, An. moucheti, An. nili, An. paludis, An. wellcomei et An. ziemanni ont eu des effectifs inférieures à 10 individus (fréquence < 0,50%).

Au final,la population anophélienne a été deux fois plus importante à Santchou (67,35% de l'effectif total) qu'à Dschang (32,65%).Si l'on compareles variations de fréquences de l'ensemble des espèces en fonction de l'altitude, on remarque que ladifférence de leur distribution dans les deux populations est très significative (÷² = 141,20 ; P < 0,005).

Huit espèces anophéliennes se sont révélées communes aux deux sites. Parmi elles, An. gambiae s.l.a présenté une fréquence relativement stable dans les deux sites altitudinaux (86,46% à Santchou et 90,30% à Dschang) ; An. funestus a été plus fréquente en altitude (7,83%) que dans la plaine (4,73%) ; An. nili, An. paludis et An. ziemannisont plus présentes dans la plaine (respectivement 1,61%, 6,16% et 1,99%) qu'en altitude (0,06%, 0,42% et 0,48%). Trois espèces sont isolées :An. namibiensis et An. pharoensis à Santchou et An. moucheti à Dschang.

3.3.2. Le cycle d'agressivité

Bien que nous ayons enregistré 11 espèces d'anophèles sur le site d'études, seules An. gambiae et An. funestusseront considérées dans la suite,car ayant des effectifsreprésentatifs et comparables. Les autres espèces ont des densités bien faibles. L'agressivité présente une augmentation continue de 18h à l'intervalle 02h-03hpour les deux espèces (figure 11), avec une différence significative entre la première tranche de la nuit (18h-00h) et la seconde(00h-06h) pour An. gambiae (÷² = 16,52 ; p = 4,81.10-5) mais pas pour An. funestus (÷² = 2,55 ; p = 0,11) (Tableau 5).

La fréquence horaire maximale de piqûres pour An. gambiae (19,20%) a été enregistrée avec une heure de retard dans la plaine (02h-03h à Santchou) contrairement en haute altitude où elle est plus faible (15,64%, 01h-02h). Cette disposition reste la même pour An. funestuschez qui le pic d'agressivité dans la plaine se situait à 01h-02h et représentait 22,12% tandis qu'il était avec une heure d'avance en altitude (00h-01h)avec une fréquence de 24,61%.

La valeur la plus élevée du nombre de piqûres par heure pour An. gambiae (n = 265 à Santchou, 02h-03h) est pratiquement 10 fois supérieure à celle de An. funestus (n = 28 à Dschang, 24h-01h).Dans la même lancée, environ 90% des piqûres par nuit sont faites par An. gambiae contre sensiblement 09% seulement pour An. funestus.

Il faut également noter que An. gambiaeen altitude présente encore un niveau d'agressivité notable à 06h du matin avec une fréquence supérieure à la moyenne (10,62%), ce qui n'est pas le cas pour An. funestus dont la densité est pratiquement nulle à cette heure-là.

Nombre de piqûres par heure

Tranches horaires

DS : Dschang (1400m) ; ST : Santchou (750m)

Figure 12 : Cycles d'agressivité des principaux vecteurs du paludisme à Santchou et Dschangd'août 2004 à novembre 2006.

Tableau 5 : Variation nocturnes des densités et fréquences des principaux vecteurs du paludisme avec l'altitudeà Santchou et Dschangd'août 2004 à novembre 2006.

 
 

Tranches de la nuit

 
 

18h-00h

 

00h-06h

Espèces

Sites

 

nombre collecté

fréquence

 

nombre collecté

fréquence

An. gambiae

Santchou

 

276

20,00%

 

1104

80,00%

Dschang

 

235

27,42%

 

622

72,58%

An. funestus

Santchou

 

30

28,85%

 

74

71,15%

Dschang

 

49

38,89%

 

77

61,11%

3.3.3. Comparaison des indices sporozoïtiques

Anopheles gambiae et An. funestus sont les seules à présenter un intérêt épidémiologique en raison de la présence des antigènes sporozoïtaires dans leurs glandes salivaires. Après les tests ELISA effectués sur 1911 anophèles à Santchou et 1172 à Dschang, nous n'avons obtenu que 29 positifs dans chaque site, ce qui nous donne comme indicessporozoïtiques (Is)1,52% et 2,47% respectivement (Tableau 6). La différence de répartition des spécimens positifs entre les deux zones n'est pas significative autant pour An. gambiae (÷² = 0,95 ; P = 0,32)que pour An. funestus(÷² = 1,36 ; P = 0,24).Le rapport des Is des deux sites montre qu'à Dschang, il est sensiblement 1,5 fois supérieur à celui de Santchou.

3.3.4. Effet de l'altitude sur l'agressivité, le taux d'inoculation entomologique et l'indice de stabilité

Les agressivités moyenne (ma) obtenue sur 264 hommes-nuits à Santchou et 288 hommes-nuits à Dschang a été de 9,34 et 5,29p/h/n(piqûres par homme et par nuit)respectivement à Santchou et Dschang, avec des valeurs plus grandes pour An. gambiae en rapport avec sa densité (Tableau 7).A partir de ces valeurs et de l'indice sporozoïtique (Is), on obtient les taux d'inoculation entomologique (he). Cette valeur, contrairement à l'Is, baisse avec l'augmentation de l'altitude :51,84pi/h/anà Santchou et 47,68pi/h/an en haute altitude. Cependant, contrairement à An. gambiaedont l'he varie peu, l'espèce An. funestus présente une augmentation 4 fois supérieure de son taux d'inoculation entomologique en altitude.

Les taux de parturité (Tp) ont été déterminés après dissections des ovaires des anophèles femelles des deux sites d'étude. Ces valeurs ont permis de calculer le taux quotidien de survie (P) ainsi que l'indice de stabilité (St) (Tableau 7). Ce taux de survie est suffisamment élevé dans les deux sites (> 88%) pour permettre le développement du parasite.L'indice de stabilité est assez élevé aux 2 niveaux d'altitude (> 2,5) pour indiquer une stabilité de paludisme mais on note qu'il a une valeur beaucoup plus grande à Dschang (7,43) qu'à Santchou (3,01).

Tableau 6 : Comparaison des indices sporozoïtiques(Is) de P. falciparum détectés par le test ELISA-CSPchez les anophèles respectivement à Santchou et Dschangd'août 2004 à novembre 2006

Espèce

 

Santchou

 

Dschang

 

Total des 2 sites

 

Nombre testés

Nombre positifs

Is (%)

 

Nombre testés

Nombre positifs

Is (%)

 

Nombre testés

Nombre positifs

Is (%)

An. coustani

 

3

0

0

 

3

0

0

 

6

0

0

An. funestus

 

98

1

1,02%

 

119

5

4,20%

 

217

6

2,76%

An. gambiae

 

1559

28

1,80%

 

1022

24

2,35%

 

2581

52

2,01%

An. hancocki

 

1

0

0

 

4

0

0

 

5

0

0

An. moucheti

 

0

0

0

 

6

0

0

 

6

0

0

An. namibiensis

 

16

0

0

 

0

0

0

 

16

0

0

An. nili

 

42

0

0

 

1

0

0

 

43

0

0

An. paludis

 

134

0

0

 

7

0

0

 

141

0

0

An. pharoensis

 

1

0

0

 

0

0

0

 

1

0

0

An. wellcomei

 

5

0

0

 

2

0

0

 

7

0

0

An. ziemanni

 

52

0

0

 

8

0

0

 

60

0

0

Total des espèces

 

1911

29

1,52%

 

1172

29

2,47%

 

3083

58

1,88%

Tableau 7 : Influence de l'altitude sur le taux d'inoculation entomologique et l'indice de stabilitéà Santchou et Dschangd'août 2004 à novembre 2006

Localité

Espèces

 

Effectifs

ma (p/h/n)

Is

(he)

 

Tp (%)

x

a

P

 

Ev (jours)

 

St

 

CNV

CPI

(pi/h/an)

 
 
 

Santchou

An. gambiae

 

2347

545

8,89

1,80%

58,41

 

73,50

2,5

0,38

89,41%

 

5,97

 

3,33

An. funestus

 

120

42

0,45

1,02%

1,69

 

78,26

3,5

0,24

90,24%

 

11,17

 

2,27

Total

 

2467

587

9,34

1,52%

51,84

 

73,69

3

0,32

91,32%

 

7,24

 

3,43

Dschang

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

An. gambiae

 

1397

102

4,85

2,35%

41,61

 

83,90

3,5

0,27

89,14%

 

16,72

 

2,20

An. funestus

 

126

4

0,44

4,20%

6,71

 

84,38

4,5

0,13

90,33%

 

22,34

 

1,20

Total

 

1523

106

5,29

2,47%

47,68

 

83,96

4

0,22

90,74%

 

16,80

 

2,04

a = indice d'anthropophilie;Ev = espérance de vie infectante des vecteurs ; he (pi/h/an) = taux d'inoculation entomologique ; Is : Indice sporozoïtique ; ma = taux d'agressivité ;P = taux quotidien de survie ; St = indice de stabilité ; Tp = taux de parturité ; x = durée du cycle gonotrophique.

3.4. DISCUSSION

3.4.1. Composition de la faune anophélienne

Ce travail nous a permis d'identifier les espèces anophéliennesprésentes respectivement au pied et au sommet de la falaise des Mbô. L'espèce An. gambiaereprésenteplus de 85% de la faune anophéliennede la zone d'étude. Cerésultat est similaire à ceuxde Shililu et al., (1998) à Mumias, ville située à 1500m d'altitude dans l'ouest du Kenya ; et à ceux de Bødkeret al., dans les hautes terres de Tanzanie. A cette espèce se joignent An. funestus(5,74%) dans les deux sites et An. paludis(4,29%) plus présente à Santchou. La faible densité des autres espèces rend leur rôle potentiel dans la transmission du paludismeen altitude négligeable. Le nombre élevé d'enquêtes nous a permis de recenser un effectif important d'espèces anophéliennes : 11 au total, soit 10 à Santchou et 9 à Dschang. Ces résultats complètent ceux de Garde et al., (1991) qui n'avait recensé que 3espèces à Dschang (An. gambiae, An. coustani et An. funestus) au cours de 3 nuits de captures (au mois de mai)et Kengne (2000) qui en avait noté 7 en 6 mois de captures (entre mai et octobre).

3.4.2. Comparaisondespopulations de vecteurs à différents niveaux altitudinaux

L'agressivité anophélienne a été plus élevée à Santchou (750m d'altitude)où elle représente sensiblement le double de celle de Dschang(1400md'altitude) : 9,34 et 5,28 p/h/n respectivement.La montée en altitude diminuerait donc les capacités reproductrices et la survie des moustiques. Il faut remarquer que la région de Santchou est plane et inondable, présentanten saisons des pluies de nombreuses flaques d'eau stagnantes propices à la ponte et au développement larvaire, ce qui n'est pas le cas à Dschang où on observe un relief plutôt accidenté. Cet élément,associés aux variations des facteurs climatiques liés à la différence d'altitude (taux d'oxygène de l'air, niveau des précipitations, température, pression osmotique, humidité...), peuvent expliquer cette grande différencedans les densitésanophéliennes.

Anopheles gambiae est la seule espèce à présenter une bonne adaptation aux deux niveaux altitudinaux. Elle présente une densité très élevée en altitude et dans la plaine, ce qui fait d'elle le principal vecteur de toute la région.

L'effet de l'altitude se fait ressentir de façon significative sur les densités de trois espèces : An. nili, An. paludis et An. ziemanni.Ces espèces sont présentes dans les deux sites mais leursfréquences en altitude sont très faibles. Il ne faut cependant pas négliger l'effet des conditions géographiques telles que la disponibilité des gîtes et la présence des hôtes préférentiels de certaines espèces sur leur distribution dans ces deux sites.

Un seul individu de An. nili a été retrouvé à Dschang contre 55 à Santchou. L'absence de cours d'eau à régime régulier servant de gîtes larvaire à cette espèce (Gillies et Coetzee, 1987 ; Carnevale et al., 1992) à Dschangpourrait en être la cause.

An. namibiensis présent à Santchou est absent sur les hautes terres. Cette espèce présente une mauvaise adaptation aux conditions altitudinales.

La présence de An. mouchetiexclusivement à Dschang et en faible nombre serait liée aux types de points d'eau présents ici. En effet, les lacs des bas-fonds aux abords couverts de végétation qui reçoivent des ruisseaux àfaible débit fournissent des gîtes propices pour cette espèce (Fontenille et al., 2003).

An. funestus est la seule espèce dont la population ne varie que faiblement entre les deux sites. Elle présente même une augmentation de fréquence en haute altitude pendant la saison sèche. Cela montre une bonne adaptation aux hautes terres lorsqu'il y a des gîtes appropriés.C'estégalement le cas à l'Ouest du Kenya où elle a été retrouvée avec l'espèceAn. gambiae jusqu'à 1700m d'altitude (Minakawa et al., 2004).

Les autres espèces ont été plutôt accidentelles, avec des effectifs assez faibles : An. pharoensis etAn. wellcomei (présent mais exophile au Soudan) sont plus inféodés à l'Afrique de l'ouest et de l'est, et An. hancocki qui a une plus grande tendance à la zoophagie et l'exophilie (Mouchet et al., 2004).

La composition de la faune résiduelle (capturée par pulvérisation) constituée principalement de An. gambiae et An. funestus révèle que ce sont là les seuls vecteurs endophiles des deux localités étudiées. Les autres espèces présentes dans l'échantillon ont plutôt présenté une bonne tendance à l'endophagie etexophilie, car présentes uniquement lors des captures nocturnes qui se sont faites à l'intérieur des cases. C'est précisément le cas de An. nili, An. paludis et An. ziemanni qui ont des effectifs assez élevés en CNV mais presque nuls en CPI. Mouchet et al., (2004) reconnaissent également An. paludis comme moustique exophile ayant une forte tendance à l'exophagie. Les autres espèces à l'instar de An. hancocki, An. coustani An. moucheti et An. namibiensis ont des effectifs faibles ne permettant pas de tirer des conclusions.

La disponibilité des gîtes larvaires conditionne la densité des adultes. C'est l'une des raisons pour lesquelles au cours de la saison sèche, les effectifs baissent considérablement dans chacune des localités.

Pendant la saison sèche, les gîtes disponibles en altitude sont les petits ruisseaux et les lacs de retenue. Ils sont propices pour le développement larvaire de An. funestus d'où sa présencecontinue pendant toute l'année. Cette espèce va donc suppléer à la baisse d'agressivité de An. gambiaedue à la baisse de sa population en saison sèche (12,42% de son effectif annuel).

La forte baisse de la densité de An. gambiae s'explique par la disparition des gîtes qu'elle affectionne : les traces de roues, les flaques d'eau claires et peu profondes dans les dénivellations de terrain, les traces de pas, les boîtesde conserve etc. ces gîtes sont asséchés en saison sèche, surtout à Santchou où le sol est sablonneux donc très perméable.D'autres espèces subissent aussi le coup de la "sècheresse", c'est le cas de An. paludis, et An. ziemanni dont les fréquences en saison sèche représentent moins de 6% des effectifs totaux. An. namibiensis, et An. moucheti absentes en captures en saison sèche sont plus adaptées à la saison des pluies. Ceci s'explique la concentration d'agents polluants dans leurs gîtes larvaires en saison sècheoù par leur assèchement.

Le cycle d'agressivité des vecteurs a été sensiblement le même dans les deux sites, il indique que le maximum de piqûres se fait au cours de la deuxième partie de la nuit. Ces observations sont conformes aux schémas habituels du cycle d'agressivité nocturne des anophèles (Gillies et De Meillon, 1968 ; Dossou et al., 1998). Cette période correspond aux moments de sommeil profond des habitants qui présentent alors un moindre risque pour les moustiques.

3.4.3. Composition du complexe An. gambiae

Au Cameroun, le complexe An. gambiae est représenté par trois espèces : An. gambiae s.s. présente dans les zones de forêt et de savane humide, An. arabiensis qui présente une distribution localisée dans la région septentrionale à climat sec et An. melas inféodée aux eaux saumâtres et présente dans la région côtière(Mouchet et al., 2004).

Dans nos sites d'étude, seule An. gambiae s.s. a été identifiée. Ces résultats sont conformes aux précédents de Wondji (2003) et Tchuinkam et al., (2004), mais diffèrent de ceux obtenus à altitude semblable au Kenya par Gimnig et al., (2001) et Koenraat et al., (2004) où une sympatrie entre An. gambiae s.s. et An. arabiensis a été notée. Deux raisons peuvent expliquer cette disparité :le climat de la région (froid et humide) qui n'est pas propice au développement de An. arabiensis plus fréquent dans les zones de savane chaudes et arides (Colluzi et al., 1979 ; Colluzi et al., 1985 ; Edilloet al., 2002). Par ailleurs, les populations humaines au Cameroun sont installées à des altitudes inférieurespar rapport au Kenya (1200m au Mont Cameroun et 1800m à Nduttitsa par Dschang) et cette absence d'hôtes limite la propagation des vecteurs dans ces régions d'altitude du pays.

L'étude des formes moléculaires de An. gambiae s.s. a révélé la présence de la seule forme moléculaire S. Ceci suit les résultats de Wondji et al., (2005) qui n'avait retrouvé qu'un seul individu de forme moléculaire M à Dschang comme à Santchou sur des effectifs de 118 et 56 respectivement. La forme M est plus fréquente dans les régions où le couvert végétal et peu dégradé à l'exemple de la zone forestière du sud Cameroun. L'adaptation de la forme S aux zones à végétation et pluviométriefaibles (Colluzi et al., 1979) expliquerait sa présence dans notre zone d'étude. La théorie d'un isolement(voire d'une exclusion) écologique entre ces deux formes (Tourré et al., 1998, Wondji et al., 2002) est égalementréaffirméepar ces résultats.

3.4.4. Les niveaux de transmission du paludisme.

La tête et le thorax seuls ont été utilisés pour le test ELISA, ceci pour limiter la surestimation de l'infestation par rapport à la présence effective de parasites dans les glandes salivaires. Seuls An. gambiae et An. funestus ont présenté des spécimens positifs au test ELISA CSP. Ce sont donc les seuls vecteurs majeurs du paludisme dans la région. An. paludis bien qu'ayant une fréquence supérieure à celle de An. funestus à Santchou, (respectivement 6,16% et 4,73%) et An. ziemanni (1,99%) n'ont pas présenté d'individu porteur de protéine CSP dans l'échantillon récolté. Ces espècesauraient doncune implication négligeable dans la transmission du paludisme comme l'a rappelé Antonio-Nkondjio (Antonio-Nkondjio et al., 2006).

Dans la plaine, An. gambiae est le vecteur majeur du paludisme, avec une agressivité élevée, un Is supérieur à celui de An. funestus et ainsi un taux d'inoculation représentant 97% du total de ce site (58,41 pi/h/an contre 1,69 pi/h/an). C'est donc, statistiquement, l'espèce responsable de la majeure partie des infections humaines ici.

En altitude, An. gambiaepossède la plus grande densité mais l'espèce An. funestus montre une proportion d'individus infectés (Is) deux fois plus grand (4,20% contre 2,35%). Son rôle dans la transmission, qui se traduit ici par un taux d'inoculation plus de trois fois supérieur à celui de la plaine, n'est pas à négliger. En observant les variations saisonnières des densités spécifiques, on peut noter que pendant la saison sèche, la fréquence de An. funestus croît de façon significative. Au cours de cette période, cette espèce suppléé donc à la déchéance de An. gambiae et contribue ainsi à maintenir la transmission à un niveau stable au cours de l'année.

Malgré l'agressivitéanophélienne plus faible en altitude, l'indice sporozoïtique est plus élevé à Dschang (2,47%) qu'a Santchou (1,52%). Cetteplus forte prévalence plasmodiale chez le vecteur peut s'expliquer par la migration des populations des basses terres plus impaludées vers les hautes terres. Cette migration est catalysée par la création d'une université dans la ville de Dschangen 1993, ce qui a occasionné l'immigrationde nombreuses personnes parmi lesquelles probablement des porteurs asymptomatiques et facilité l'importation des parasites. Le niveau de transmission est resté cependant élevé à Santchou (51,84 pi/h/an) par rapport à Dschang (47,68 pi/h/an) car le taux d'agressivité est très faible en altitude.

Le taux de survie (P) des anophèles calculé est suffisant dans les deux sites pour permettre aux parasites d'effectuer entièrement leur cycle intrinsèque : 91% et 90% respectivement en aval et en amont, valeurs supérieures au seuil de 65% définit par Bruce-Chwatt (1985). Cependant, la durée du cycle extrinsèque du plasmodium étant rallongée ici par la basse température, la transmission s'en trouve affectée et réduit l'efficacité des vecteurs (Bødker et al., 2003 ; Githeko et al., 2001).

L'indice de stabilité est supérieur à 2,5 dans le sitede Santchou (3,43), traduisant une stabilité de la transmission du paludisme, ce qui n'est pas le cas à Dschang où on note un niveau de stabilité intermédiaire (0,5 < Is < 2,5) avec un indice de stabilité de 2,04. En effet, dans la zone de plaine, la présence de vastes zones marécageuses et du fleuve Nkam qui serpente la plaine permet aux vecteurs de se reproduire abondamment en saisons pluvieuses mais le sol étant sablonneux, les gîtes sont rares en saison sèche ce qui se traduit par une baisse de l'agressivité anophélienne. Ce schémas reste le même tous les ans et induit une stabilité de la transmission du paludisme.Dans le site de haute altitude, l'indice de stabilité est inférieur au niveau minimum de stabilité mais n'en est cependant pas bien éloigné. Ceci s'expliquerait par le fait queAn. funestus s'associe au vecteur majeur An. gambiae en saison sèche, rendant la transmission plus ou moins continue au cours de l'année. Ces résultats sont compatibles aux prévisions des zonesd'altitudes où on s'attendà retrouver un paludisme instable présentant des résurgences en périodes de pullulation de vecteurs (Fontenille et al., 1990 ; Mouchet et al., 2004).

En altitude, la baisse de la température et de l'hygrométrie sont à l'origine du rallongement du cycle gonotrophique (Rhodain et Perez, 1985). Les valeurs de la durée du cycle gonotrophique sont d'un jour supérieur avec l'altitude pour les deux espèces (Tchuinkam et al., 2007). Ces valeurs, associées à des taux de parturité aussi élevés, augmentent considérablement l'espérance de vie infectante dans le site altitudinal. Il est donc indispensable pour les vecteurs de vivre plus longtemps pour pouvoir transmettre le parasite. En effet, comme le cycle gonotrophique (nombre de jours entre deux repas de sang) est plus long en altitude, le moustique prendra moins de repas de sang au cours de sa vie. Ainsi, la transmission réelle du parasite est réduite dans la ville de Dschang.

Le réchauffement climatique actuel peut agir sur ces constantes car une augmentation de la température moyenne va entrainer un raccourcissement du cycle extrinsèque du parasite ainsi que du cycle gonotrophique du vecteur. On notera alors une fréquence d'inoculation des parasites bien supérieure à celle qui sévit actuellement et les populations étant peu ou pas prémunies, un TIE subitement plus élevé pourrait entrainer des risques d'épidémie.

CONCLUSION ET PERSPECTIVES

Cette étude entomologique et moléculaire avait pour objectif de faire ressortirl'impact d'une dénivellation altitudinale brusque sur la composition spécifique de la faune anophélienne et caractériser la transmission du paludisme dans unerégion de l'Ouest Cameroun. Elles'est déroulée dans deux sites géographiquement rapprochés mais séparés par une falaisequi créé une différence climatique importante entre eux : Santchou (750m) etDschang (1400m d'altitude).

L'agressivité anophélienne baisse avec la montée en altitude pour la plus part des espèces. An. gambiaes.s. s'est révélé être le principal vecteur dans les deux sites où il a présenté les plus grands taux d'inoculation entomologiques. Il est secondé par An. funestus qui joue un rôle important en saison sèche en altitude. Ces deux espèces ont été les seules porteuses des parasites. Cependant, si la montée en altitude entraine une réduction importante des populations anophéliennes, elle pas le même impact sur le degré d'infection des vecteurs qui se révèle être plus élevé sur le plateau.

Bien que la différence des taux de parturité ne soit pas significative, l'augmentation de la durée du cycle gonotrophique qui intervient exponentiellement dans la formule de l'espérance de vie infectante fait que celle-ci soit plus longue en altitude que dans la plaine.

Il est probable eu égard à la fragilité du climat dans cette zone, que le réchauffement climatique global auxquels s'ajoutent l'urbanisation sans cesse croissante et le bitumage récent de la route Dschang-Santchou modifient ce faciès écologique et offrent de nouvelles conditions écologiques et dynamiques aux différents acteurs de la transmission,ce qui pourrait affecter le niveau d'endémie palustre.

En perspectives, nous nous proposons pour compléter ce travail, de :

· étendre cette étude à d'autres sites du pays : la région du Mont Cameroun où sont présents des sites à haute altitude, afin de confirmer si nécessaire les résultats obtenus ;

· étudier la structuration génétique des populations de An. gambiae et An. funestusde ces deux localités afin dedéterminer et analyser les modifications génétiques adaptatives des anophèles aux climats de hautes altitudes.

RÉFÉRENCES BIBLIOGRAPHIQUES

Antonio-Nkondjio C., Simard F, Awono-Ambene HP., Toto JC, Tchuinkam T & Fontenille D., 2006. Complexity of malaria vectorial system in Cameroon: contribution of secondary vectors to malaria transmission. J. Med. Entomo.;sous presse.

Awono-Ambene, H.P.; Kengne, P.; Simard, F.; Antonio-Nkondjio, C.; Fontenille, D. 2004. Description and bionomics of Anopheles (Cellia) ovengensis (Diptera: Culicidae), a new malaria vector species of the Anopheles nili group from South Cameroon. J. Med. Entomo.; 41(4), 561-568.

Aubry Pierre, 2007. Paludisme, actualités, 2006. Med. Trop.;65, 3-6.

Beier J.C., Killeen G.F., Githure J.I., 1999. Entomologic inoculation rates and Plasmodium falciparum malaria prevalence in Africa. Am. J. Trop. Med. Hyg.; 61, 109-113.

Bødker R., Akida J., Shayo D., Kisinza W., Msangeni H. A., Pedersen E. M., and Lindsay S. W., 2003. Relationship between altitude and intensity of malaria transmission in the Usambara mountains, Tanzania. J. Med. Entomo.; 40(5), 706-717.

Boudin C., Bonnel S., Tchuinkam T., Gougna L. C., Gounoue R., Manga L., 1998.L'évaluation des niveaux de transmission palustre : méthodologies et paramètres. Med. Trop. ; 58, 69-75.

Bruce-Chwatt L. J., 1980a. Essential Malariology. W. Heinemann,Medical Books Ltd. London, 166-210.

Bruce-Chwatt L. J., 1980b. The rise and fall of malaria in Europe. London : Oxford University Press; 124-136.

Brunhes J.; Le Goff G.; Geoffroy B., 1999.Afro-tropical anopheline mosquitoes. III. Description of three new species: An. carnevalei sp nov. An. hervyi sp nov. and An. dualaensis sp nov. and resurrection of An. rageaui. J. Am. Mosq. Control. Assoc. ; 15,552-558.

Carnevale P. et Mouchet J., 1990. Formation continue : techniques d'enquêtes entomologiques pour l'étude du paludisme.Bull. liais. doc. OCEAC ; (91-92), 79-83.

Carnevale P., Le Goff G., Toto JC., Robert V., 1992.Anopheles nili as the main vector of human malaria in villages of southern Cameroon. Med. Vet. Entomol. ; 6, 135-138.

Carter R., Schofield L., mendis K., 1992. HLA effects in malaria: increased parasite-killing immunity or reduced immunopathology? Parasitology today ; 8, 41-42 & 57.

Chandre F., Darriet F., Manga L., Akogbeto M., Faye O., Mouchet J., Guillet P., 1999. Status of pyrethroid resistance in Anopheles gambiae s.l.Bull. OMS ; 77: (3), 230-234.

Clements, A.N. 1992. The biology of mosquitoes. Chapman & Hall. London ;128-134, 241-253.

Coetzee M., Craig M. and Le Suer D. 2000. Distribution of African Malaria Mosquitoes Belonging to the Anopheles gambiae Complex. Parasitology today ; 16. (2), 74-77.

Colluzi M., Sabatini A., Petrarca V., and Di Deco M. A., 1979.Chromosomal différenciation and adaptation to human environments in the An. gambiae complex. Trans. Roy. Soc. Trop. Med. Hyg.; 73,483-497.

Coluzzi M., Petrarca V., Di Deco M. A., 1985. Chromosomal inversion intergradation and incipient speciation in Anopheles gambiae . Bol. Zool.; 52, 45-63.

Combemale P., 2001.La prescription des répulsifs. Med. Trop.; 61, 99-103

Cornel A., Collins F. H., 1996. PCR of ribosomal DNA Intergenic Spacer Regions as a method for identifying mosquitoes in the Anopheles gambiae complex. Meth. Mol. Biol. ; 50, 321-332.

Danis M. et Mouchet J., 1991. Paludisme, Universités Francophones UREF. Edition marketing ELLIPSE,23-58.

Davidson G., 1954. Estimation of the survival rate of Anopheline mosquitoes in nature. Nature ; 174, 792-793.

Davidson G., 1962. Anopheles gambiae complex. Nature ; 196, 894-905.

Davidson G., 1964. The five mating-types in a An. gambiae complex. Revisita di Malariologia ; 13, 167-183.

Della Torre A., Fanello C., Akogbeto M. Dossou Yovo J., Flavia G., Petrarca V., Coluzzi M., 2001. Molecular evidence of incipient speciation within Anopheles gambiae s.s. in West Africa. Insect biochemistry and molecular Biology ;10, 9-18.

Della Torre A., Zhijian Tu, Vincenzo Petrarca.,2005. On the distribution and genetic differentiation of Anopheles gambiae s.s. molecular forms ;Insect biochemistry and molecular Biology ; 35, 755-759.

Dossou-Yovo J., Diarrassouba S., Doannio J., Darriet F. & Carnevale P., 1998. Le cycle d'agressivité d'Anophelesgambiaes.s. à l'intérieur des maisons et la transmission du paludisme dans la région de Bouaké (Côte d'Ivoire). Entomologie médicale ; 1953, 66-73.

Edillo F. E., Toure Y. T., Lanzaro G. C., Guimogo D., and Taylor C. E., 2002. Spatial and habitat distribution of Anophelesgambiae and Anopheles arabiensis (Diptera Culicidae) in Banam bani Village, Mali. J. Med. Entomo.;39 (1), 70-77.

Eldrige F. B., 2005. Mosquitoes, the Culicidae. In Marquardt C. W., Black C. W., Freier E. J., Hagedorn H. H., Hemingway J., Higgs S., James A. A., More G. C., 2005. Biology of Disease Vectors, ElsevierAcademic Press, 2;95-101.

Fanello C., Santolamazza F. and Della Torre A., 2002. Simultaneous identification of species and molecular forms of the Anopheles gambiae complex by PCR-RFLP. Med. Vet. Entomol.; 16, 461-464.

Farooq U. and Mahajan R. C. 2004.Drug resistance in malaria. Vector Borne Diseases ; 41:45-53.

Fontaine R. E., Pull J. H., Payne D., 1978. Evaluation of fenithrothion for the control of malaria. Bull. WHO; 56, 445-452.

Fontenille D. and Simard F. 2004. Unravelling complexities in human malaria transmission dynamics in Africa through a comprehensive knowledge of vector populations. Comp. Immunol. Microbiol.& Inf. Diseases ; 27,357-375.

Fontenile D., Cohuet A., Awono-Ambene H. P., Antonio-Nkondjio C., Wondji C. S., Kengne P., Dia I., Boccolini D., Duchemin J. B., Rajaonarivelo V., Dabire R., Adja-Akre, Ceainu C., Le Goff G., Simard F.,2003.Systématique et biologie des Anophèles vecteurs de paludisme en Afrique : Données récentes. Med. Trop. ; 63,247-253.

Fontenille D., Lepers J.P. Campbell G.H., Rakotoarivony L. Coluzzi M., Coulanges P. 1990. Malaria vectors and their role in transmission, in Ntsoa in the highland Plateaux of Madagascar from 1988 to 1990. Arch.Inst. Pasteur, Madagascar ;57(l), 335-368.

Fontenille D., Wanji S., Djouaka R., Awono Ambene H. P., 2000.Anopheles hancocki, vecteur secondaire du paludisme au Cameroun. Bull. Liais. Doc. OCEAC ; 33 (2),23-26.

Garde X., Njan A., Toto J-C., Carnevale P., Robert V., 1991. Entomologie et paludisme : Résultats d'une enquête entomologique à Dschang (Cameroun). Ouest santé ; 3,3-12.

Garnham P. C., 1945. Malaria epidemics at exceptionally high altitudes in Kenya. Br. Med. J.; 2,45-47.

Garnham P. C., 1966.Malaria parasites and others haemosoridia. Oxford : Blackwell Scientific publication, 144 p.

Garret-Jones C., 1964. Prognosis for interruption of malaria transmission through assessment of the mosquito vectorial capacity. Nature ;204, 1173-1175.

Garret-Jones C. and Shidr-awi GR., 1969. Malaria vectorial capacity of a population of Anophelcs gambiae.Bull. WHO ; 40, 531-545.

Gentilini M. et Nozais J. P., 1991. Histoire du paludisme. In Danis M. & Mouchet J. (eds). Paludisme. Edition Marketing/Ellipses, Paris ;17-20.

Gillies M. T. andCotzee M., 1987. A supplement to the Anophelinae of Africa South of the Sahara (Afrotropical region). The South African Institute for Medical Research ;55, 43-62.

Gillies M. T. and De Meillon B., 1968. The Anophelinae of Africa south of the Sahara (Ethiopian zoogeographical region) The South African Institute for Medical Research;2, 101-143.

Githeko A. K. And W. Ndegwa, 2001. Predicting malaria epidemics using climate data in Kenyan highlands: a tool for decision makers. Global Change Hum. Health ; 2, 54-63.

Hamad A., Amel A., Abd el Hamid, 2002. A marked seasonality of malaria transmission in two rural sites in eastern Sudan.Vector Borne Diseases ; 38:34-41.

Harbach R. E., 2004. The classification of genus Anopheles (Diptera: Culicidae): a working hypothesis of phylogenetics relationship. Bull. Ent. Res.;94, 537-553

Hunt R.H., Coetzee M., Fettene M., 1998. The Anopheles gambiae complex: a new species from Ethiopia. Trans. Roy. Soc. Trop. Med. Hyg.;231-235.

Kamau L., Hunt R., Coetzee M., 2002.Analysis of the population structure of Anopheles funestus (Diptera: Culicidae) from western and coastal Kenya using paracentric chromosomal inversion frequencies. J. Med. Entomo.; 39,78-83

Kengne Honoré, 2000. Etude de la transmission entomologique du paludisme dans quatre quartiers de la ville de Dschang. Mémoire de Maîtrise en Biologie Animale de l'université de Dschang. Cameroun ; 56p.

Koenraadt C. J. M., Githeko A. K., Takken W., 2004. The effects of rainfall and evapo-transpiration on the temporal dynamics of Anopheles gambiae s.s. and Anopheles arabiensis in a Kenyan village. Acta Tropica ; 90,141-153

Lane P. R. and Crosskey R. W., 1993. Medical insects and arachnids. Chapman and Hall, London, 723p

Lindsay, S. W.,and Martens W. J., 1998. Malaria in the African highlands: past, present and future. Bull. WHO; 76,33-45.

MacDonald G., 1957. The epidemiology and control of malaria. Oxford University Press Edition, London ;201p.

Miller M., 1958. Observations on the natural history of malaria in the semi-resistant West African, Trans. Roy. Soc. Trop. Med. Hyg.;52, 152-168.

Minakawa N., Sonye G., Mogi M., Githeko A., Yan G., 2002. The effects of climatic factors on the distribution and abundance of Malaria vectors. J. Med. Entomo. ; 39 (6), 833-841.

Minakawa N., Sonye G., Mogi M., Yan G., 2004. Habitat characteristics of Anopheles gambiae ss larvae in Kenyan highland. Med. Vet. Entomol.; 18 (3),301-305.

[Minsanté] Ministère de la santé du Cameroun,2002. Plan stratégique de lutte contre le paludisme au Cameroun, 17p.

Mouchet J., Carnevale, P., 1991. Les vecteurs et la transmission. In Danis, M., Mouchet, J. (eds). Paludisme. Edition Marketing/Ellipses, Paris ;35-58.

Mouchet J., Carnevale P., Coosemans M., Julvez J., Manguin S., Richard-Lenoble D. et SircoulonJ., 2004. Biodiversité du paludisme dans le monde. Edition John Libbey ; 12-37, 64-84, 114-117.

[MSP] Ministère de la Santé Publique, 2001. Plan National Stratégique de Lutte contre le Paludisme. Yaoundé, Draft 1 ; 42-53.

Muirhead-Thompson R. C., 1945. Studies on the breeding places and control of Anopheles gambiae var. melas in coastal district of Sierra Leone. Bull. Entomol. Res.; 36,185-252.

Ndenga B., Githeko A., Omukunda E., Munyekenye G., Harrysonne A., Wamai P., Mbogo C., Minakawa N., Zhou G., And Yan Guiyun, 2006. Population dynamics of malaria vectors in western Kenya highlands. J. Med. Entomo.; 43(2),200-206.

Njan Nloga A., Robert V., Toto J-C., et Carnevale P., 1993.Anopheles moucheti, vecteur principal du paludisme au Sud-Cameroun. Bull. liais. Doc. OCEAC, 26 (2) ;69-72.

[OMS] Organisation Mondiale de la Santé, 2003. Evaluation de la santé. In: Rapport sur la santé dans le Monde : La vie au 21e siècle, une perspective pour tous.World Health Organisation (Ed), Genève, suisse ; 43-65.

[OMS] Organisation Mondiale de la Santé, 2005.Rapport mondial sur le paludisme 2005 : Paludisme, situation dans le monde ; 1-3.

[OMS/UNICEF] Organisation Mondiale de la Santé/Organisation des nations unies pour l'enfance (2003). Le rapport sur le paludisme en Afrique. WHO/CDS/MAL/2003 ; 1093, 120p.

Rodhain François, 1999. Les maladies à vecteurs, Collection entomologiqueQue sais-je ? Presse universitaires de France ;3-47.

Rodhain F. et Pérez C., 1985. Précis d'entomologie médicale et vétérinaire, Notion d'épidémiologie des maladies à vecteurs. Maloine s. a.;77-152.

Samé Ekobo A., 2005. Aspect épidémiologique du paludisme au Cameroun. Malaria research and control in Cameroon. Journal of the Cameroon Academy of Sciences ; 5,3-24.

Service M. W., 1993.Mosquito Ecology: Field sampling methods, 2nd edition, Elesevier, Ampplied Science Publisher, London ; 988p.

Shililu J. I., Maier W.A., Seitz H.M., and Orago A.S., 1998. Seasonal density, sporozoite rates and entomological in oculation rates of Anopheles gambiae and Anopheles funestus in a high-altitude sugar cane growing zone in Western Kenya. Trop. Med. Int. Health ; 3,706-710.

Smith P. G. and Milligan P. J., 2005. Malaria vaccine: 3 or 6 months' protection? Lancet ;365, 472- 473.

Tchuinkam Timoléon, 2007. Biologie et épidémiologie de la transmission homme-moustique de Plasmodiumfalciparum : rôle de la gamétocytémie, influence des antimalariques et implications pour le paludisme d'altitude. Thèse d'Etat, Université de Yaoundé I.

Tchuinkam T., Wandji S. et Fondjo E.,2004. Biodiversité des Anophèles et dynamique de la transmission du paludisme en zones d'altitude au Cameroun. Rapport du projet ; 5-9, 34-35.

Walker Kathleen, 2002. A Review of Control Methods for African Malaria Vectors. Environmental Health Project, Activity Report ; 108,12-28.

Wéry Marc, 1995. Protozoologie médicale. De Boeck & Lacier, Bruxelles ;137-178.

White, G.B. 1985.Anopheles bwambae sp. n. A malaria vector in the Semliki Valley, Uganda, and is relationships whit other sibling species of the Anopheles gambiae complex (Dipteria: Culicidae). Systematic Entomology ; 10,510-522.

[WHO] World Health Organization, 1975. Manual on practical entomology in malaria, PartII. Methods and techniques. No.13, WHO. Geneva, Switzerland.

Wilkes T. J., Matola Y. G., Charlwood J. D., 1996. Anopheles rivulorum, a vector of human malaria in Africa. Med. Vet. Entomol.; 10,108-110.

Wondji Charles Sinclair, 2003. Variabilité et structure génétique despopulations d'Anopheles gambiae (Gilles, 1902), vecteur du paludisme au Cameroun. Thèse de Doctorat 3em cycle, Université de Yaoundé I ; 180p.

Wondji C., Simard F. and Fontenille D., 2002. Evidence for genetic differentiation between the molecular forms M and S within the Forest chromosomal form of Anopheles gambiae in an area of sympatry. Insect Molecular Biology ;11(1),11-19

Wondji C., Frédéric S., Vincenzo P., Josiane E., Federica S., Alessandra D. T. And Didier F., 2005. Species and populations of the Anopheles gambiae complex in Cameroon with special emphasis on chromosomal and molecular forms of Anopheles gambiae s.s.J. Med. Entomo.; 42(6),998-1005

Wirtz R.A., Zavala F., Charoenvit Y., Campbell G.H., Burkot T.R., Schneider I., Esser K.M., Beaudoin R.L., Andre R.G., 1987. Comparative testing of monoclonal antibodies against Plasmodium falciparum sporozoites for ELISA development. Bull WHO ; 65,39-45.

Zhou G., N. Minakawa, A. K. Githeko and G. Yan. 2004. Association between climate variability and malaria epidemics in the East African highlands. Proc. Natl. Acad. Sci. U.S.A ; 101,2375-2380.

ANNEXES

ANNEXE1

Tableau A :Composition du Tampon de broyage (Cornel et Collins, 1996)

Réactifs

Concentration finale

Quantité (Pour 100 ml)

NaCl

0,08 M

1,6 ml (5 M NaCl)

Sucrose

0,16 M

5,48g

EDTA

0,06 M

12 ml (0,5 M EDTA pH 8)

Tris-HCl

0,10 M

10 ml (1 M Tris-HCl pH 9)

SDS

0,05%

5 ml (10% SDS)

Eau distillée stérile (ED)

q.s.p

71,4 ml

Tableau B : Milieu réactionnel pour PCR complexe An. gambiae (Fanello et al.,2002)

Réactif

Concentration initiale

Concentration finale

Volume/tube

Tampon (+MgCl2)

10X

1X

2,50 ul

dNTPs

5mM

0,2mM

1,00 ul

Amorces

UN

10uM

5pmoles

0,50 ul

GA

10uM

5pmoles

0,50 ul

AR

10uM

5pmoles

0,50 ul

ML .

10uM

5pmoles

0,50 ul

Taq DNA polymérase

5UI/ul

0,25UI

0,05 ul

H2O distillé

 

q.s.p

17,45 ul

ADN

 
 

2,00 ul

Total

 
 

25,00 ul

Amorces : AR : arabiensis,GA : gambiae,ML: melas, UN : universelle ;UI : Unités internationales ;

Tableau C : Composition du "Master MIX" pour la digestion enzymatique de l'ADN de An. gambiae s.s. (Fanello et al., 2002).

Réactif

Concentration initiale

Concentration finale

Volume partube(ul)

Tampon

10X

1X

2,50

Enzyme Hhal

10UI/ul

0,1UI/ul

0,25

ddH2O

 
 

12,25

ADN

 
 

10,00

X : Concentration de la solution tampon ; UI : unités internationales ;ddH2O : Eau bi-distillée

ANNEXE 2 :

-Séquences des amorces utilisées pour l'identification des espèces du complexe Anopheles gambiae

Amorce

Séquence

Taille du fragment

amplifié

Universelle (UN)

5' GTGTGCCCCTTCCTCGATGT 3'

 

An. arabiensis (AR)

5'AAGTGTCCTTCTCCATCCTA 3'

315 pb

An. gambiae (GA)

5'CTGGTTTGGTCGGCACGTTT 3'

390pb

An. melas (ML)

5'TGACCAACCCACTCCCTTGA 3'

464pb

-Représentation schématique du test diagnostic de 3 espèces membres du complexe Anophelesgambiaed'après Scott et al., (1993)

UN

AR

GA

ML

-

Région conservée du génome (cheztoutes les espèces)

Régions variables et séquences spécifiques d'espèce

+

An. arabiensis

An. melas

An. gambiae

ANNEXE 3

1 2 3 4 56 7 8910 11 12

A

B

C

D

E

F

G

H

Moustique à tester (1 spécimen par puits)

Témoins négatifs(PBS ou BB)

Témoin positifP. falciparum

Figure A : Plaque de Nunc à 96 puitsutilisée pour les tests ELISA monospécifique

Echantillon positif

Puits de dépôt

témoins

Numéro de la plaque

Figure B : Photo d'une plaque montrant un résultat de test ELISA

ANNEXE 4

Réactifs et quantité pour ELISA-CSP

PBS (Phosphate Buffered Saline)

Reconstituer le PBS en poudre Sigma : 9,7 g dans un litre d'eau distillée

NP40/BB = Nonidet P40 pour une plaque 2ml = 25ul NP 40 + 2 ml BB (blocking buffer), agiter

(préparer pour 5 plaques 10 ml + 125 ul NP 40)

BB (blocking buffer) : Dans un litre PBS, ajouter :

1) 5 gde Caséine

2) 0,1 g de Thiomérosal

3) 0,04 g de phenol red

4) 10 g de BSA

Laisser sur l'agitateur deux heures

PBS/TWEEN 20 - 500 ul de Tween 20 dans 1 l de PBS, agiter

Substrat de Peroxydase = pour 3 plaques :

· 5 mg d'Ortho-tolidine dans 0,25ml de N,N-diméthylformamide

· 30 ml de Tampon citrate

· 12ul de H2O2 à 10% (ou 4 ul 0 30%, ou 6ul à 20% ).

Tampon Citrate pH4

- Préparer le Tampon Citrate pH4 : pour 1 litre :

Acide citique,

Hydroxyde de Sodium 4,48g

- Dissoudre la soude dans 200ml d'eau bidistillée, puis l'acide citrique dans cette solution. Ajouter 400ml d'eau bidistillée. Ajuster le pH à 4 avec l'acide Chlorhydrique 1N. Compléter à 1 l avec l'eau bidistillée.

Reconstitution des anticorps monoclonaux lyophilisés (acm)

· milieu reconstitution = ½ volume H2O + ½ volume Glycérol

- 1,0 mg ACm + 2 ml milieu reconstitution

- 0,5 mg ACm + 1 ml milieu reconstitution

- 0,25 mg ACm + 0,5 ml milieu reconstitution

Quantité d'ACm nécessaire :

- Sensibilisation : ACm capture dans du PBS

- Capture pour une plaque

P. falciparum : 15 ul/5 ml PBS

- Révélation : ACm conjugués à peroxydase dans BB

- Conjugues pour une plaque

P. falciparum : 7,5 ul/5ml BB

ANNEXE 5

Abstract présenté au "CIS-SOCAB-CCAM Scientific Symposium", 22-25 Avril 2007

Titre :Variations altitudinale et latitudinale de la composition spécifique du complexe An. gambiae au Cameroun

Auteurs :Billy TENE FOSSOG, Timoléon TCHUINKAM, Samuel WANDJI, Etienne FONDJO, Thomas NJINE, Mpoame MBIDA, Didier FONTENILE, Frédéric SIMARD.

Introduction :

Considéré comme étant le meilleur vecteur du paludisme au monde, An. gambiae sl a été élevé au rang de complexe d'espèce et subdivisé en 7 sous-espèces dont An gambiae ss Giles 1902, An arabiensis Patton 1905et An melas Théobalt 1903 présentes au Cameroun. Toutefois, leur distribution n'est pas homogène sur tout le térritiore. Nous avons étudié la repartition des membres de ce complexe suivant un transect altitudinal et latitudinal dans 3 régions cibles situées le long de la "ligne du Cameroun".

Méthodologie :

Les zones d'étude sont présentées dans le tableau ci-dessous. Les récoltes d'échantillons y ont été faites suivant 3 méthodes: le "dipping" pour les larves, la capture sur homme et les pulvérisations intra domiciliaires de pyrèthre pour les adultes. Les échantillons récoltés ont été identifiés morphologiquement (espèces) puis génétiquement (sous espèces). Les analyses génétiques ont été faites sur des extraits d'ADN amplifiés suivant des techniques de PCR spécifiques (PCR complexe et PCR M/S) puis migrés sur gel d'agarose pour comparaisons.

Région

Mont Cameroun

Hauts plateaux

Monts Mandara

Site

Debundscha

Mutengéné

Meanja

Likoko

Buea

Santchou

Dschang

Godola

Mokolo

Altitude

50 m

220m

300m

800m

1200m

750m

1400m

450m

900m

Résultats :

An. gambiae sl est présent dans tous les sites étudiés mais sa population décroît avec la montée en altitude et en latitude. Au niveau de la plus faible altitude et latitude (Debundscha), An melas a été retrouvé bien que à une faible proportion de 6,8% en association avec An gambiae ss , mais cette espèce disparaît dès qu'on s'éloignement de la côte, confirmant ainsi son adaptation aux eaux saumâtres. Loin des côtes (altitudinalement et latitudinalement), les populations d'An gambiae sl sont composées exclusivement de An gambiae ss, jusqu'à une certaine altitude et latitude. Au nord du pays, An. arabiensis est apparu en proportion supérieure à An. gambiae ss (93% et 60% respectivement) (Graphe 1).

La composition des formes moléculaires M et S de An gambiae ss varie également en altitude et en latitude.. La forme M est prédominante aux basses altitudes (100% à Debundscha) et se fait remplacer progressivement avec la montée en altitude (50% à Mutengéné, 14% à Godola) jusqu'à disparaître complètement Buea et à Dschang, où il y a plutôt 100% de forme S (Graphe 2).

Interprétation :

La plasticité de An gambiae sl lui confère une grande capacité d'adaptation, puisqu'il est présent sur tout le long du transect altitudinal, avec prédominance d'aval en amont de : An melas, An gambiae ss - M, An gambiae ss -S et probablement An arabiensis dans les sommets. Cette composition spécifique du complexe varie également avec la latitude mais dans un rapport de distance 1000 fois moins vite qu'avec l'altitude. Elle serait fonction des conditions climatiques et des types de gîtes larvaires présents.

Les 2 formes moléculaires peuvent dans certains sites être sympatriques ; seulement même dans ces conditions, on observe pas d'hybride. La nature de la pression de sélection reste donc à déterminer pour cerner le processus de spéciation en cours. Elle est probablement de nature écologique et se retrouverait à mi-altitude et à mi-latitude.

Graphe 1 : variation de la composition spécifiqueGraphe 2 : Proportion des formes moléculaires avec la

en fonction de l'altitude latitude

Références : Mouchet et al., : biodiversité du paludisme dans le monde, 2004 ;

C. WONDJI et al, J. M. Ent, 2005,

D. FONTENILLE, med. Trop, 2003

* 1L'antigène Duffy sur la paroi de l'érythrocyte est nécessaire à la pénétration du mérozoïte de P. vivax

* 2intervalle entre 2 repas de sang

* * Plante dont les fleurs produisent une poudre insecticide

* ** Temps nécessaire pour que l'insecticide agisse sur les moustiques

* 3Au-delà de 35 cycles, l'enzyme de réplication (la Taq polymérase) est dénaturée