WOW !! MUCH LOVE ! SO WORLD PEACE !
Fond bitcoin pour l'amélioration du site: 1memzGeKS7CB3ECNkzSn2qHwxU6NZoJ8o
  Dogecoin (tips/pourboires): DCLoo9Dd4qECqpMLurdgGnaoqbftj16Nvp


Home | Publier un mémoire | Une page au hasard

 > 

Bio-écologie des anophèles de part et d'autre de la falaise des Mbô et leur implication dans la transmission du paludisme d'altitude


par Billy TENE
Université de Yaoundé 1 - DEA 2007
  

précédent sommaire

CONCLUSION ET PERSPECTIVES

Cette étude entomologique et moléculaire avait pour objectif de faire ressortirl'impact d'une dénivellation altitudinale brusque sur la composition spécifique de la faune anophélienne et caractériser la transmission du paludisme dans unerégion de l'Ouest Cameroun. Elles'est déroulée dans deux sites géographiquement rapprochés mais séparés par une falaisequi créé une différence climatique importante entre eux : Santchou (750m) etDschang (1400m d'altitude).

L'agressivité anophélienne baisse avec la montée en altitude pour la plus part des espèces. An. gambiaes.s. s'est révélé être le principal vecteur dans les deux sites où il a présenté les plus grands taux d'inoculation entomologiques. Il est secondé par An. funestus qui joue un rôle important en saison sèche en altitude. Ces deux espèces ont été les seules porteuses des parasites. Cependant, si la montée en altitude entraine une réduction importante des populations anophéliennes, elle pas le même impact sur le degré d'infection des vecteurs qui se révèle être plus élevé sur le plateau.

Bien que la différence des taux de parturité ne soit pas significative, l'augmentation de la durée du cycle gonotrophique qui intervient exponentiellement dans la formule de l'espérance de vie infectante fait que celle-ci soit plus longue en altitude que dans la plaine.

Il est probable eu égard à la fragilité du climat dans cette zone, que le réchauffement climatique global auxquels s'ajoutent l'urbanisation sans cesse croissante et le bitumage récent de la route Dschang-Santchou modifient ce faciès écologique et offrent de nouvelles conditions écologiques et dynamiques aux différents acteurs de la transmission,ce qui pourrait affecter le niveau d'endémie palustre.

En perspectives, nous nous proposons pour compléter ce travail, de :

· étendre cette étude à d'autres sites du pays : la région du Mont Cameroun où sont présents des sites à haute altitude, afin de confirmer si nécessaire les résultats obtenus ;

· étudier la structuration génétique des populations de An. gambiae et An. funestusde ces deux localités afin dedéterminer et analyser les modifications génétiques adaptatives des anophèles aux climats de hautes altitudes.

RÉFÉRENCES BIBLIOGRAPHIQUES

Antonio-Nkondjio C., Simard F, Awono-Ambene HP., Toto JC, Tchuinkam T & Fontenille D., 2006. Complexity of malaria vectorial system in Cameroon: contribution of secondary vectors to malaria transmission. J. Med. Entomo.;sous presse.

Awono-Ambene, H.P.; Kengne, P.; Simard, F.; Antonio-Nkondjio, C.; Fontenille, D. 2004. Description and bionomics of Anopheles (Cellia) ovengensis (Diptera: Culicidae), a new malaria vector species of the Anopheles nili group from South Cameroon. J. Med. Entomo.; 41(4), 561-568.

Aubry Pierre, 2007. Paludisme, actualités, 2006. Med. Trop.;65, 3-6.

Beier J.C., Killeen G.F., Githure J.I., 1999. Entomologic inoculation rates and Plasmodium falciparum malaria prevalence in Africa. Am. J. Trop. Med. Hyg.; 61, 109-113.

Bødker R., Akida J., Shayo D., Kisinza W., Msangeni H. A., Pedersen E. M., and Lindsay S. W., 2003. Relationship between altitude and intensity of malaria transmission in the Usambara mountains, Tanzania. J. Med. Entomo.; 40(5), 706-717.

Boudin C., Bonnel S., Tchuinkam T., Gougna L. C., Gounoue R., Manga L., 1998.L'évaluation des niveaux de transmission palustre : méthodologies et paramètres. Med. Trop. ; 58, 69-75.

Bruce-Chwatt L. J., 1980a. Essential Malariology. W. Heinemann,Medical Books Ltd. London, 166-210.

Bruce-Chwatt L. J., 1980b. The rise and fall of malaria in Europe. London : Oxford University Press; 124-136.

Brunhes J.; Le Goff G.; Geoffroy B., 1999.Afro-tropical anopheline mosquitoes. III. Description of three new species: An. carnevalei sp nov. An. hervyi sp nov. and An. dualaensis sp nov. and resurrection of An. rageaui. J. Am. Mosq. Control. Assoc. ; 15,552-558.

Carnevale P. et Mouchet J., 1990. Formation continue : techniques d'enquêtes entomologiques pour l'étude du paludisme.Bull. liais. doc. OCEAC ; (91-92), 79-83.

Carnevale P., Le Goff G., Toto JC., Robert V., 1992.Anopheles nili as the main vector of human malaria in villages of southern Cameroon. Med. Vet. Entomol. ; 6, 135-138.

Carter R., Schofield L., mendis K., 1992. HLA effects in malaria: increased parasite-killing immunity or reduced immunopathology? Parasitology today ; 8, 41-42 & 57.

Chandre F., Darriet F., Manga L., Akogbeto M., Faye O., Mouchet J., Guillet P., 1999. Status of pyrethroid resistance in Anopheles gambiae s.l.Bull. OMS ; 77: (3), 230-234.

Clements, A.N. 1992. The biology of mosquitoes. Chapman & Hall. London ;128-134, 241-253.

Coetzee M., Craig M. and Le Suer D. 2000. Distribution of African Malaria Mosquitoes Belonging to the Anopheles gambiae Complex. Parasitology today ; 16. (2), 74-77.

Colluzi M., Sabatini A., Petrarca V., and Di Deco M. A., 1979.Chromosomal différenciation and adaptation to human environments in the An. gambiae complex. Trans. Roy. Soc. Trop. Med. Hyg.; 73,483-497.

Coluzzi M., Petrarca V., Di Deco M. A., 1985. Chromosomal inversion intergradation and incipient speciation in Anopheles gambiae . Bol. Zool.; 52, 45-63.

Combemale P., 2001.La prescription des répulsifs. Med. Trop.; 61, 99-103

Cornel A., Collins F. H., 1996. PCR of ribosomal DNA Intergenic Spacer Regions as a method for identifying mosquitoes in the Anopheles gambiae complex. Meth. Mol. Biol. ; 50, 321-332.

Danis M. et Mouchet J., 1991. Paludisme, Universités Francophones UREF. Edition marketing ELLIPSE,23-58.

Davidson G., 1954. Estimation of the survival rate of Anopheline mosquitoes in nature. Nature ; 174, 792-793.

Davidson G., 1962. Anopheles gambiae complex. Nature ; 196, 894-905.

Davidson G., 1964. The five mating-types in a An. gambiae complex. Revisita di Malariologia ; 13, 167-183.

Della Torre A., Fanello C., Akogbeto M. Dossou Yovo J., Flavia G., Petrarca V., Coluzzi M., 2001. Molecular evidence of incipient speciation within Anopheles gambiae s.s. in West Africa. Insect biochemistry and molecular Biology ;10, 9-18.

Della Torre A., Zhijian Tu, Vincenzo Petrarca.,2005. On the distribution and genetic differentiation of Anopheles gambiae s.s. molecular forms ;Insect biochemistry and molecular Biology ; 35, 755-759.

Dossou-Yovo J., Diarrassouba S., Doannio J., Darriet F. & Carnevale P., 1998. Le cycle d'agressivité d'Anophelesgambiaes.s. à l'intérieur des maisons et la transmission du paludisme dans la région de Bouaké (Côte d'Ivoire). Entomologie médicale ; 1953, 66-73.

Edillo F. E., Toure Y. T., Lanzaro G. C., Guimogo D., and Taylor C. E., 2002. Spatial and habitat distribution of Anophelesgambiae and Anopheles arabiensis (Diptera Culicidae) in Banam bani Village, Mali. J. Med. Entomo.;39 (1), 70-77.

Eldrige F. B., 2005. Mosquitoes, the Culicidae. In Marquardt C. W., Black C. W., Freier E. J., Hagedorn H. H., Hemingway J., Higgs S., James A. A., More G. C., 2005. Biology of Disease Vectors, ElsevierAcademic Press, 2;95-101.

Fanello C., Santolamazza F. and Della Torre A., 2002. Simultaneous identification of species and molecular forms of the Anopheles gambiae complex by PCR-RFLP. Med. Vet. Entomol.; 16, 461-464.

Farooq U. and Mahajan R. C. 2004.Drug resistance in malaria. Vector Borne Diseases ; 41:45-53.

Fontaine R. E., Pull J. H., Payne D., 1978. Evaluation of fenithrothion for the control of malaria. Bull. WHO; 56, 445-452.

Fontenille D. and Simard F. 2004. Unravelling complexities in human malaria transmission dynamics in Africa through a comprehensive knowledge of vector populations. Comp. Immunol. Microbiol.& Inf. Diseases ; 27,357-375.

Fontenile D., Cohuet A., Awono-Ambene H. P., Antonio-Nkondjio C., Wondji C. S., Kengne P., Dia I., Boccolini D., Duchemin J. B., Rajaonarivelo V., Dabire R., Adja-Akre, Ceainu C., Le Goff G., Simard F.,2003.Systématique et biologie des Anophèles vecteurs de paludisme en Afrique : Données récentes. Med. Trop. ; 63,247-253.

Fontenille D., Lepers J.P. Campbell G.H., Rakotoarivony L. Coluzzi M., Coulanges P. 1990. Malaria vectors and their role in transmission, in Ntsoa in the highland Plateaux of Madagascar from 1988 to 1990. Arch.Inst. Pasteur, Madagascar ;57(l), 335-368.

Fontenille D., Wanji S., Djouaka R., Awono Ambene H. P., 2000.Anopheles hancocki, vecteur secondaire du paludisme au Cameroun. Bull. Liais. Doc. OCEAC ; 33 (2),23-26.

Garde X., Njan A., Toto J-C., Carnevale P., Robert V., 1991. Entomologie et paludisme : Résultats d'une enquête entomologique à Dschang (Cameroun). Ouest santé ; 3,3-12.

Garnham P. C., 1945. Malaria epidemics at exceptionally high altitudes in Kenya. Br. Med. J.; 2,45-47.

Garnham P. C., 1966.Malaria parasites and others haemosoridia. Oxford : Blackwell Scientific publication, 144 p.

Garret-Jones C., 1964. Prognosis for interruption of malaria transmission through assessment of the mosquito vectorial capacity. Nature ;204, 1173-1175.

Garret-Jones C. and Shidr-awi GR., 1969. Malaria vectorial capacity of a population of Anophelcs gambiae.Bull. WHO ; 40, 531-545.

Gentilini M. et Nozais J. P., 1991. Histoire du paludisme. In Danis M. & Mouchet J. (eds). Paludisme. Edition Marketing/Ellipses, Paris ;17-20.

Gillies M. T. andCotzee M., 1987. A supplement to the Anophelinae of Africa South of the Sahara (Afrotropical region). The South African Institute for Medical Research ;55, 43-62.

Gillies M. T. and De Meillon B., 1968. The Anophelinae of Africa south of the Sahara (Ethiopian zoogeographical region) The South African Institute for Medical Research;2, 101-143.

Githeko A. K. And W. Ndegwa, 2001. Predicting malaria epidemics using climate data in Kenyan highlands: a tool for decision makers. Global Change Hum. Health ; 2, 54-63.

Hamad A., Amel A., Abd el Hamid, 2002. A marked seasonality of malaria transmission in two rural sites in eastern Sudan.Vector Borne Diseases ; 38:34-41.

Harbach R. E., 2004. The classification of genus Anopheles (Diptera: Culicidae): a working hypothesis of phylogenetics relationship. Bull. Ent. Res.;94, 537-553

Hunt R.H., Coetzee M., Fettene M., 1998. The Anopheles gambiae complex: a new species from Ethiopia. Trans. Roy. Soc. Trop. Med. Hyg.;231-235.

Kamau L., Hunt R., Coetzee M., 2002.Analysis of the population structure of Anopheles funestus (Diptera: Culicidae) from western and coastal Kenya using paracentric chromosomal inversion frequencies. J. Med. Entomo.; 39,78-83

Kengne Honoré, 2000. Etude de la transmission entomologique du paludisme dans quatre quartiers de la ville de Dschang. Mémoire de Maîtrise en Biologie Animale de l'université de Dschang. Cameroun ; 56p.

Koenraadt C. J. M., Githeko A. K., Takken W., 2004. The effects of rainfall and evapo-transpiration on the temporal dynamics of Anopheles gambiae s.s. and Anopheles arabiensis in a Kenyan village. Acta Tropica ; 90,141-153

Lane P. R. and Crosskey R. W., 1993. Medical insects and arachnids. Chapman and Hall, London, 723p

Lindsay, S. W.,and Martens W. J., 1998. Malaria in the African highlands: past, present and future. Bull. WHO; 76,33-45.

MacDonald G., 1957. The epidemiology and control of malaria. Oxford University Press Edition, London ;201p.

Miller M., 1958. Observations on the natural history of malaria in the semi-resistant West African, Trans. Roy. Soc. Trop. Med. Hyg.;52, 152-168.

Minakawa N., Sonye G., Mogi M., Githeko A., Yan G., 2002. The effects of climatic factors on the distribution and abundance of Malaria vectors. J. Med. Entomo. ; 39 (6), 833-841.

Minakawa N., Sonye G., Mogi M., Yan G., 2004. Habitat characteristics of Anopheles gambiae ss larvae in Kenyan highland. Med. Vet. Entomol.; 18 (3),301-305.

[Minsanté] Ministère de la santé du Cameroun,2002. Plan stratégique de lutte contre le paludisme au Cameroun, 17p.

Mouchet J., Carnevale, P., 1991. Les vecteurs et la transmission. In Danis, M., Mouchet, J. (eds). Paludisme. Edition Marketing/Ellipses, Paris ;35-58.

Mouchet J., Carnevale P., Coosemans M., Julvez J., Manguin S., Richard-Lenoble D. et SircoulonJ., 2004. Biodiversité du paludisme dans le monde. Edition John Libbey ; 12-37, 64-84, 114-117.

[MSP] Ministère de la Santé Publique, 2001. Plan National Stratégique de Lutte contre le Paludisme. Yaoundé, Draft 1 ; 42-53.

Muirhead-Thompson R. C., 1945. Studies on the breeding places and control of Anopheles gambiae var. melas in coastal district of Sierra Leone. Bull. Entomol. Res.; 36,185-252.

Ndenga B., Githeko A., Omukunda E., Munyekenye G., Harrysonne A., Wamai P., Mbogo C., Minakawa N., Zhou G., And Yan Guiyun, 2006. Population dynamics of malaria vectors in western Kenya highlands. J. Med. Entomo.; 43(2),200-206.

Njan Nloga A., Robert V., Toto J-C., et Carnevale P., 1993.Anopheles moucheti, vecteur principal du paludisme au Sud-Cameroun. Bull. liais. Doc. OCEAC, 26 (2) ;69-72.

[OMS] Organisation Mondiale de la Santé, 2003. Evaluation de la santé. In: Rapport sur la santé dans le Monde : La vie au 21e siècle, une perspective pour tous.World Health Organisation (Ed), Genève, suisse ; 43-65.

[OMS] Organisation Mondiale de la Santé, 2005.Rapport mondial sur le paludisme 2005 : Paludisme, situation dans le monde ; 1-3.

[OMS/UNICEF] Organisation Mondiale de la Santé/Organisation des nations unies pour l'enfance (2003). Le rapport sur le paludisme en Afrique. WHO/CDS/MAL/2003 ; 1093, 120p.

Rodhain François, 1999. Les maladies à vecteurs, Collection entomologiqueQue sais-je ? Presse universitaires de France ;3-47.

Rodhain F. et Pérez C., 1985. Précis d'entomologie médicale et vétérinaire, Notion d'épidémiologie des maladies à vecteurs. Maloine s. a.;77-152.

Samé Ekobo A., 2005. Aspect épidémiologique du paludisme au Cameroun. Malaria research and control in Cameroon. Journal of the Cameroon Academy of Sciences ; 5,3-24.

Service M. W., 1993.Mosquito Ecology: Field sampling methods, 2nd edition, Elesevier, Ampplied Science Publisher, London ; 988p.

Shililu J. I., Maier W.A., Seitz H.M., and Orago A.S., 1998. Seasonal density, sporozoite rates and entomological in oculation rates of Anopheles gambiae and Anopheles funestus in a high-altitude sugar cane growing zone in Western Kenya. Trop. Med. Int. Health ; 3,706-710.

Smith P. G. and Milligan P. J., 2005. Malaria vaccine: 3 or 6 months' protection? Lancet ;365, 472- 473.

Tchuinkam Timoléon, 2007. Biologie et épidémiologie de la transmission homme-moustique de Plasmodiumfalciparum : rôle de la gamétocytémie, influence des antimalariques et implications pour le paludisme d'altitude. Thèse d'Etat, Université de Yaoundé I.

Tchuinkam T., Wandji S. et Fondjo E.,2004. Biodiversité des Anophèles et dynamique de la transmission du paludisme en zones d'altitude au Cameroun. Rapport du projet ; 5-9, 34-35.

Walker Kathleen, 2002. A Review of Control Methods for African Malaria Vectors. Environmental Health Project, Activity Report ; 108,12-28.

Wéry Marc, 1995. Protozoologie médicale. De Boeck & Lacier, Bruxelles ;137-178.

White, G.B. 1985.Anopheles bwambae sp. n. A malaria vector in the Semliki Valley, Uganda, and is relationships whit other sibling species of the Anopheles gambiae complex (Dipteria: Culicidae). Systematic Entomology ; 10,510-522.

[WHO] World Health Organization, 1975. Manual on practical entomology in malaria, PartII. Methods and techniques. No.13, WHO. Geneva, Switzerland.

Wilkes T. J., Matola Y. G., Charlwood J. D., 1996. Anopheles rivulorum, a vector of human malaria in Africa. Med. Vet. Entomol.; 10,108-110.

Wondji Charles Sinclair, 2003. Variabilité et structure génétique despopulations d'Anopheles gambiae (Gilles, 1902), vecteur du paludisme au Cameroun. Thèse de Doctorat 3em cycle, Université de Yaoundé I ; 180p.

Wondji C., Simard F. and Fontenille D., 2002. Evidence for genetic differentiation between the molecular forms M and S within the Forest chromosomal form of Anopheles gambiae in an area of sympatry. Insect Molecular Biology ;11(1),11-19

Wondji C., Frédéric S., Vincenzo P., Josiane E., Federica S., Alessandra D. T. And Didier F., 2005. Species and populations of the Anopheles gambiae complex in Cameroon with special emphasis on chromosomal and molecular forms of Anopheles gambiae s.s.J. Med. Entomo.; 42(6),998-1005

Wirtz R.A., Zavala F., Charoenvit Y., Campbell G.H., Burkot T.R., Schneider I., Esser K.M., Beaudoin R.L., Andre R.G., 1987. Comparative testing of monoclonal antibodies against Plasmodium falciparum sporozoites for ELISA development. Bull WHO ; 65,39-45.

Zhou G., N. Minakawa, A. K. Githeko and G. Yan. 2004. Association between climate variability and malaria epidemics in the East African highlands. Proc. Natl. Acad. Sci. U.S.A ; 101,2375-2380.

ANNEXES

ANNEXE1

Tableau A :Composition du Tampon de broyage (Cornel et Collins, 1996)

Réactifs

Concentration finale

Quantité (Pour 100 ml)

NaCl

0,08 M

1,6 ml (5 M NaCl)

Sucrose

0,16 M

5,48g

EDTA

0,06 M

12 ml (0,5 M EDTA pH 8)

Tris-HCl

0,10 M

10 ml (1 M Tris-HCl pH 9)

SDS

0,05%

5 ml (10% SDS)

Eau distillée stérile (ED)

q.s.p

71,4 ml

Tableau B : Milieu réactionnel pour PCR complexe An. gambiae (Fanello et al.,2002)

Réactif

Concentration initiale

Concentration finale

Volume/tube

Tampon (+MgCl2)

10X

1X

2,50 ul

dNTPs

5mM

0,2mM

1,00 ul

Amorces

UN

10uM

5pmoles

0,50 ul

GA

10uM

5pmoles

0,50 ul

AR

10uM

5pmoles

0,50 ul

ML .

10uM

5pmoles

0,50 ul

Taq DNA polymérase

5UI/ul

0,25UI

0,05 ul

H2O distillé

 

q.s.p

17,45 ul

ADN

 
 

2,00 ul

Total

 
 

25,00 ul

Amorces : AR : arabiensis,GA : gambiae,ML: melas, UN : universelle ;UI : Unités internationales ;

Tableau C : Composition du "Master MIX" pour la digestion enzymatique de l'ADN de An. gambiae s.s. (Fanello et al., 2002).

Réactif

Concentration initiale

Concentration finale

Volume partube(ul)

Tampon

10X

1X

2,50

Enzyme Hhal

10UI/ul

0,1UI/ul

0,25

ddH2O

 
 

12,25

ADN

 
 

10,00

X : Concentration de la solution tampon ; UI : unités internationales ;ddH2O : Eau bi-distillée

ANNEXE 2 :

-Séquences des amorces utilisées pour l'identification des espèces du complexe Anopheles gambiae

Amorce

Séquence

Taille du fragment

amplifié

Universelle (UN)

5' GTGTGCCCCTTCCTCGATGT 3'

 

An. arabiensis (AR)

5'AAGTGTCCTTCTCCATCCTA 3'

315 pb

An. gambiae (GA)

5'CTGGTTTGGTCGGCACGTTT 3'

390pb

An. melas (ML)

5'TGACCAACCCACTCCCTTGA 3'

464pb

-Représentation schématique du test diagnostic de 3 espèces membres du complexe Anophelesgambiaed'après Scott et al., (1993)

UN

AR

GA

ML

-

Région conservée du génome (cheztoutes les espèces)

Régions variables et séquences spécifiques d'espèce

+

An. arabiensis

An. melas

An. gambiae

ANNEXE 3

1 2 3 4 56 7 8910 11 12

A

B

C

D

E

F

G

H

Moustique à tester (1 spécimen par puits)

Témoins négatifs(PBS ou BB)

Témoin positifP. falciparum

Figure A : Plaque de Nunc à 96 puitsutilisée pour les tests ELISA monospécifique

Echantillon positif

Puits de dépôt

témoins

Numéro de la plaque

Figure B : Photo d'une plaque montrant un résultat de test ELISA

ANNEXE 4

Réactifs et quantité pour ELISA-CSP

PBS (Phosphate Buffered Saline)

Reconstituer le PBS en poudre Sigma : 9,7 g dans un litre d'eau distillée

NP40/BB = Nonidet P40 pour une plaque 2ml = 25ul NP 40 + 2 ml BB (blocking buffer), agiter

(préparer pour 5 plaques 10 ml + 125 ul NP 40)

BB (blocking buffer) : Dans un litre PBS, ajouter :

1) 5 gde Caséine

2) 0,1 g de Thiomérosal

3) 0,04 g de phenol red

4) 10 g de BSA

Laisser sur l'agitateur deux heures

PBS/TWEEN 20 - 500 ul de Tween 20 dans 1 l de PBS, agiter

Substrat de Peroxydase = pour 3 plaques :

· 5 mg d'Ortho-tolidine dans 0,25ml de N,N-diméthylformamide

· 30 ml de Tampon citrate

· 12ul de H2O2 à 10% (ou 4 ul 0 30%, ou 6ul à 20% ).

Tampon Citrate pH4

- Préparer le Tampon Citrate pH4 : pour 1 litre :

Acide citique,

Hydroxyde de Sodium 4,48g

- Dissoudre la soude dans 200ml d'eau bidistillée, puis l'acide citrique dans cette solution. Ajouter 400ml d'eau bidistillée. Ajuster le pH à 4 avec l'acide Chlorhydrique 1N. Compléter à 1 l avec l'eau bidistillée.

Reconstitution des anticorps monoclonaux lyophilisés (acm)

· milieu reconstitution = ½ volume H2O + ½ volume Glycérol

- 1,0 mg ACm + 2 ml milieu reconstitution

- 0,5 mg ACm + 1 ml milieu reconstitution

- 0,25 mg ACm + 0,5 ml milieu reconstitution

Quantité d'ACm nécessaire :

- Sensibilisation : ACm capture dans du PBS

- Capture pour une plaque

P. falciparum : 15 ul/5 ml PBS

- Révélation : ACm conjugués à peroxydase dans BB

- Conjugues pour une plaque

P. falciparum : 7,5 ul/5ml BB

ANNEXE 5

Abstract présenté au "CIS-SOCAB-CCAM Scientific Symposium", 22-25 Avril 2007

Titre :Variations altitudinale et latitudinale de la composition spécifique du complexe An. gambiae au Cameroun

Auteurs :Billy TENE FOSSOG, Timoléon TCHUINKAM, Samuel WANDJI, Etienne FONDJO, Thomas NJINE, Mpoame MBIDA, Didier FONTENILE, Frédéric SIMARD.

Introduction :

Considéré comme étant le meilleur vecteur du paludisme au monde, An. gambiae sl a été élevé au rang de complexe d'espèce et subdivisé en 7 sous-espèces dont An gambiae ss Giles 1902, An arabiensis Patton 1905et An melas Théobalt 1903 présentes au Cameroun. Toutefois, leur distribution n'est pas homogène sur tout le térritiore. Nous avons étudié la repartition des membres de ce complexe suivant un transect altitudinal et latitudinal dans 3 régions cibles situées le long de la "ligne du Cameroun".

Méthodologie :

Les zones d'étude sont présentées dans le tableau ci-dessous. Les récoltes d'échantillons y ont été faites suivant 3 méthodes: le "dipping" pour les larves, la capture sur homme et les pulvérisations intra domiciliaires de pyrèthre pour les adultes. Les échantillons récoltés ont été identifiés morphologiquement (espèces) puis génétiquement (sous espèces). Les analyses génétiques ont été faites sur des extraits d'ADN amplifiés suivant des techniques de PCR spécifiques (PCR complexe et PCR M/S) puis migrés sur gel d'agarose pour comparaisons.

Région

Mont Cameroun

Hauts plateaux

Monts Mandara

Site

Debundscha

Mutengéné

Meanja

Likoko

Buea

Santchou

Dschang

Godola

Mokolo

Altitude

50 m

220m

300m

800m

1200m

750m

1400m

450m

900m

Résultats :

An. gambiae sl est présent dans tous les sites étudiés mais sa population décroît avec la montée en altitude et en latitude. Au niveau de la plus faible altitude et latitude (Debundscha), An melas a été retrouvé bien que à une faible proportion de 6,8% en association avec An gambiae ss , mais cette espèce disparaît dès qu'on s'éloignement de la côte, confirmant ainsi son adaptation aux eaux saumâtres. Loin des côtes (altitudinalement et latitudinalement), les populations d'An gambiae sl sont composées exclusivement de An gambiae ss, jusqu'à une certaine altitude et latitude. Au nord du pays, An. arabiensis est apparu en proportion supérieure à An. gambiae ss (93% et 60% respectivement) (Graphe 1).

La composition des formes moléculaires M et S de An gambiae ss varie également en altitude et en latitude.. La forme M est prédominante aux basses altitudes (100% à Debundscha) et se fait remplacer progressivement avec la montée en altitude (50% à Mutengéné, 14% à Godola) jusqu'à disparaître complètement Buea et à Dschang, où il y a plutôt 100% de forme S (Graphe 2).

Interprétation :

La plasticité de An gambiae sl lui confère une grande capacité d'adaptation, puisqu'il est présent sur tout le long du transect altitudinal, avec prédominance d'aval en amont de : An melas, An gambiae ss - M, An gambiae ss -S et probablement An arabiensis dans les sommets. Cette composition spécifique du complexe varie également avec la latitude mais dans un rapport de distance 1000 fois moins vite qu'avec l'altitude. Elle serait fonction des conditions climatiques et des types de gîtes larvaires présents.

Les 2 formes moléculaires peuvent dans certains sites être sympatriques ; seulement même dans ces conditions, on observe pas d'hybride. La nature de la pression de sélection reste donc à déterminer pour cerner le processus de spéciation en cours. Elle est probablement de nature écologique et se retrouverait à mi-altitude et à mi-latitude.

Graphe 1 : variation de la composition spécifiqueGraphe 2 : Proportion des formes moléculaires avec la

en fonction de l'altitude latitude

Références : Mouchet et al., : biodiversité du paludisme dans le monde, 2004 ;

C. WONDJI et al, J. M. Ent, 2005,

D. FONTENILLE, med. Trop, 2003

précédent sommaire