WOW !! MUCH LOVE ! SO WORLD PEACE !
Fond bitcoin pour l'amélioration du site: 1memzGeKS7CB3ECNkzSn2qHwxU6NZoJ8o
  Dogecoin (tips/pourboires): DCLoo9Dd4qECqpMLurdgGnaoqbftj16Nvp


Home | Publier un mémoire | Une page au hasard

 > 

La nécropole mérovingienne "la chapelle" de Jau-Dignac et Loirac (Garonne): Détermination de liens de parenté par approche paléogénétique


par Diane Thibon
Université de Bordeaux 1 - Master 2 2009
  

précédent sommaire suivant

3. Méthodes

L'analyse génétique se divise en deux grandes étapes importantes.

La première est l'obtention des séquences ADN, par les méthodes d'extraction, d'amplification de l'ADN, de clonage et de séquençage qui vous seront décrites.

La seconde est l'analyse de ces séquences: alignement des séquences de clones, détection de contaminations et de déaminations, authentification des séquences, comparaison avec d'autres séquences issues de base de données, et identification d'haplogroupe. Le détail des protocoles est présenté dans les annexes (annexe A).

3.1. Précautions

Bien entendu, un certain nombre de précautions vis-à-vis des contaminations doivent être prises tout au long de la première étape et notamment avant l'amplification ADN, puisque tout contaminant intégré est préférentiellement amplifié par la PCR. Neuf critères d'authenticité de l'ADN ont été élaborés (Gilbert 2005 ; Poinar 2003). Les plus importants d'entre eux ont été respectés dans le cadre de cette étude :

- Échantillonnage propre

- Port de gants, charlotte, combinaison, blouses. - Utilisation de matériel et ustensiles stériles.

- Nettoyage régulier du matériel et de la paillasse à la javel et aux UV.

- Séparation physique des laboratoires ADN ancien - Salle blanche en surpression, avec sas et UV

- Séparation des salles d'extraction et de préparation des PCR

- Séparation des laboratoires pré et post-PCR

- Plusieurs contrôles négatifs d'extraction et de PCR - Clonage puis séquençage des produits PCR

Il est important d'insister sur le fait que la détection de contaminations est essentielle et plus encore dans cette étude. En effet, de par sa provenance géographique ainsi que sa faible ancienneté (seulement 1500 ans), ce matériel génétique pourrait être tout à fait comparable et similaire aux contaminations exogènes modernes potentielles (manipulateurs, réactifs), rendant ainsi l'authentification plus ardue.

3.2. Préparations des échantillons

Les échantillons, après avoir été prélevés, ont été placés au congélateur dans des sachets stériles empêchant tout contact avec l'extérieur.

En laboratoire, des dents en place non cassées sont été extraites des alvéoles, raclées à l'aide d'un scalpel puis nettoyées à la javel et rincées à l'eau stérile (le tout sous hotte stérile UV). L'échantillon préparé est ensuite mis en sachet stérile double marqué.

3.3. Extraction de l'ADN

Cette étape se déroule sur une demi-journée en salle blanche. Il convient de signaler une fois pour toute que tout le matériel contenu au sein de cette salle est stérile. La stérilisation des locaux et matériels est obtenue par nettoyage à la javel et exposition aux UV.

En premier lieu, la dent est broyée grossièrement à l'aide d'un marteau puis la poudre en résultant est mélangée à un tampon de lyse (EDTA + NaOH + N-Lauryl sarcosyl + Protéinase K). Le tout est placé en étuve à 37°C toute la nuit. Cette étape de « digestion » va permettre la lyse des cellules et la libération des acides nucléiques de l'échantillon au sein de la solution. Le deuxième jour, la solution subit une étape de déprotéinisation, par séparation sur gradient de phénol-chloroforme. Cette étape va permettre la séparation de l'ADN et des constituants lipidiques et protéiques. Cette deuxième journée s'achève avec la filtration et purification de l'extrait grâce à des colonnes (Centricons). Cette dernière étape permet la concentration de l'ADN ainsi que l'élimination de diverses particules inhibitrices de PCR. Parallèlement, un tube témoin extraction (sans ADN) suit l'étape d'extraction.

3.4. Amplification de l'ADN

Cette étape débute avec le mélange des réactifs PCR ou mix réalisé en salle blanche mais au sein d'une petite pièce spécifique. Ce mélange contient des dNTP (désoxyribonucléiques tri phosphates) qui permettront l'étape d'élongation, l'enzyme Taq polymérase qui va réaliser cette polymérisation ainsi que les amorces spécifiques qui servent de point d'ancrage et de départ à la polymérisation. Associé à cela d'autres constituants comme du tampon 2x, du BSA, du Mgcl2 et de l'eau sont incorporés au mélange. Une fois l'ADN ajouté, le mélange est prêt pour l'amplification.

La technique de la PCR (Polymerase Chain Reaction) permet l'amplification de fragments d'ADN à partir de très petite quantité d'ADN. Ce système, indispensable en paléogénétique, va ainsi nous permettre d'obtenir des millions de copie de notre région cible HVRI. Comme il est possible de le voir sur la figure 9, cette PCR se déroule en 3 étapes et est réalisée par une seule et même machine destinée à cette fonction (thermocycler).

La dénaturation, étape de séparation des deux brins d'ADN, s'effectue en une minute à une température de 94 O.

Lors de l'étape suivante, l'hybridation, un couple d'amorce spécifique va venir s'hybrider sur les brins d'ADN (voir détail des amorces spécifiques à chaque fragment tableau 3). Cette étape dure 45 secondes et la température d'hybridation est spécifique au couple d'amorce utilisé.

Pour finir, l'ADN est synthétisé lors de la phase d'élongation ou polymérisation. Cette étape ne dure qu'une minute et est réalisée à une température de 72°C.

L'ADN est ainsi synthétisé de manière exponentielle durant un nombre de cycle prédéfinis. Au sein du LAPP, 45 cycles sont estimés nécessaires pour une bonne amplification. Le risque étant qu'un nombre de cycles trop important rende la PCR plus sensible aux contaminations, aboutissant ainsi à la détection quasi-systématique d'ADN contaminant (liés aux réactifs) au sein des témoins (Yang 2003).

Figure 9 : Schéma d'une amplification d'ADN par PCR (Vierstraete 1999).

De la même façon que lors de l'extraction, un témoin négatif PCR est réalisé. Une fois l'ADN transporté dans une autre salle, un autre témoin aérosol contenant le mix PCR reste ouvert pendant tout le temps de la manipulation afin de vérifier la pureté de l'air de la salle blanche.

Fragment

Amorce

séquences des amorces

ille (pb)

HVSI complet

HVSIcompU

CCCAAAGCTAAGATTCTAAT

421

56

 

HVSIcompL

GAGGATGGTGGTCAAGGGAC

 
 

HVSI A

HVSIaU

CCCAAAGCTAAGATTCTAAT

186

56

 

HVSIaL

TGGATTGGGTTTTATGTA

 
 

HVSI B

HVSIbU

TGACCACCTGTAGTACATAA

174

56

 

HVSIbL

GGAGTTGCAGTTGATGT

 
 

HVSI C

HVSIcU

CCCCATGCTTACAAGCAAGT

261

56

 

HVSIcL2

GAGGATGGTGGTCAAGGGAC

 
 

HVSI CC

HVSIccU

CCCCATGCTTACAAGCAAGT

133

56

 

HVSIccL

TGGCTTTATGTACTATGTAC

 
 

Tableau 3 : Amorces utilisées pour chaque fragment (Jehaes et al. 2001).

3.5. Vérification de PCR

Cette étape consiste tout simplement à vérifier que l'ADN a bien été amplifié en quantité suffisante. Pour cela, une électrophorèse est réalisée. En premier lieu, un gel d'agarose est fabriqué puis l'ADN y est incorporé par l'intermédiaire de puits. Du bleu de bromophénol est ajouté à l'ADN afin d'alourdir le mélange et de permettre de visualiser le front de migration. Un marqueur de taille est également déposé dans certains puits afin de servir d'échelle. Le gel, une fois chargé, est introduit dans l'électrophorèse ou il est immergé dans un tampon qui permettra la conduction du courant électrique. Une fois le courant établi les échantillons vont migrer différentiellement selon la taille et la charge des fragments d'ADN. Les petits fragments migreront plus vite que les gros qui seront ralentis dans les mailles du gel. Le gel est ensuite trempé dans du BET (bromure d'éthidium), intercalant qui permettra ensuite la révélation des bandes d'ADN sous UV. La taille des fragments est enfin estimée par comparaison au marqueur de poids moléculaire.

3.6. Clonage

Les échantillons pour lesquels on a obtenu un signal sont clonés. Cette étape de clonage permet de visualiser l'ensemble des séquences ADN présentes dans un même produit PCR, permettant ainsi de séparer les potentielles séquences contaminantes des séquences authentiques. En effet, comme nous l'avons vu précédemment, la PCR va préférentiellement amplifier l'ADN le plus abondant et le moins dégradé, ce qui n'est pas souvent compatible avec l'ADN ancien. La première étape de ce clonage est la ligation : elle permet l'insertion du fragment ADN d'intérêt dans la bactérie, par l'intermédiaire de vecteurs. Ces bactéries sont

ensuite mises en culture dans un milieu contenant de l'ampicilline, un antibiotique, puis mises à incuber. Seules les bactéries ayant inséré le fragment d'intérêt, sont résistantes à l'ampicilline et peuvent se développer. Une fois les colonies formées, celles-ci seront récupérées, formant ainsi un stock d'ADN. Afin de vérifier que les bactéries ont bien intégré le fragment de taille attendue, une PCR ainsi qu'une vérification sur gel d'agarose sont réalisées. Dans le cas d'un clonage réussi, les échantillons sont envoyés à séquencer (entreprise Co-genics), ce qui nous permettra d'obtenir la succession des bases des séquences d'intérêt.

3.7. Analyse des séquences

Après le retrait des vecteurs et des amorces des séquences, la première étape est l'alignement des séquences (clones, témoins, ADN des manipulateurs et fouilleurs, contaminations répertoriées au sein du laboratoire), à l'aide du logiciel Bioedit.

La comparaison directe des séquences entres elles ainsi qu'avec la séquence de référence d'Anderson va nous permettre de repérer les mutations sur les clones mais aussi de détecter les séquences contaminantes, les erreurs de réplication lors de la PCR et les phénomènes de déamination. Il est particulièrement important de comparer les séquences obtenues dans les témoins et les séquences des tubes contenant des extraits d'ADN ancien. En effet, Lorsque de l'ADN est retrouvé dans les témoins, celui-ci est issu de contamination provenant de plusieurs sources (réactifs d'extraction ou d'amplification, manipulateurs du laboratoire ou encore séquences étudiées précédemment dans le laboratoire). Par conséquent, toute séquence d'ADN ancien identique à une séquence retrouvée au sein des témoins sera considérée comme contamination.

Lorsqu'une séquence présentant des mutations est authentifiée, il est ensuite possible d'aller chercher des informations concernant ces mutations dans les bases de données du net (Blast NCB I, http://www.ncbi.nlm.nih.gov/): ont-elles été répertoriées, référencées, sont-elles caractéristiques d'un haplogroupe ? Ces informations sont acquises à partir du site http://www.stats.gla.ac.uk/~vincent/founder2000/ présentant une base de données de séquences mitochondriales obtenues pour un grand nombre de populations Européennes et proche-orientales (Richards 2000).

3.8. Typage des fouilleurs

Le typage des fouilleurs s'effectue de la même manière que les analyses réalisées sur de l'ADN actuel. Nous avons envoyé à chacun des fouilleurs un kit de prélèvement buccal afin de pouvoir récupérer l'ADN issu des cellules épithéliales de l'intérieur de la joue. En une journée, l'extraction, l'amplification et la vérification de la PCR sont réalisées.

Les étapes d'extraction et d'amplification ne s'effectuent pas en salle blanche car la quantité d'ADN, normalement assez abondante, permet à la PCR d'être insensible aux contaminations extérieures. Pour cette même raison, l'étape de clonage n'est pas non plus réalisée. L'étape d'extraction se trouve très réduite par rapport à celle effectuée en ADN ancien. La partie concernant le broyage des échantillons est bien sûr absente pour ces analyses ainsi que l'étape de purification. Les produits utilisés lors de l'extraction sont un peu différents de ceux retrouvés pour l'ADN ancien. Ceux-ci sont utilisés sous forme de kit ce qui réduit encore un peu le temps passé pour la réalisation de cette étape.

L'ADN étant normalement en très bon état il est alors inutile de fragmenter la région HVR1. En conséquence, les amorces utilisées pour la PCR vont amplifier toute cette région (voir tableau 4).

précédent sommaire suivant