WOW !! MUCH LOVE ! SO WORLD PEACE !
Fond bitcoin pour l'amélioration du site: 1memzGeKS7CB3ECNkzSn2qHwxU6NZoJ8o
  Dogecoin (tips/pourboires): DCLoo9Dd4qECqpMLurdgGnaoqbftj16Nvp


Home | Publier un mémoire | Une page au hasard

 > 

Diversité génétique des Rhizobia associés à† un champ de pois d'Angole (Cajanus cajan l.) à† Yamoussoukro (centre de la Côte d'Ivoire)

( Télécharger le fichier original )
par Kouakou Romain FOSSOU
Ecole supérieure d'agronomie de l'institut national polytechnique Félix HouphouŽt Boigny de Yamoussoukro - Diplôme d'agronomie approfondie  2011
  

précédent sommaire suivant

Bitcoin is a swarm of cyber hornets serving the goddess of wisdom, feeding on the fire of truth, exponentially growing ever smarter, faster, and stronger behind a wall of encrypted energy

VII.2.3.2- Réalisation de la PCR-RFLP

VII.2.3.2.1 - Principe de la PCR

La PCR (SAIKI et al., 1985 ; MULLIS et FALOONA, 1987) se réalise dans un mélange réactionnel contenant de faibles quantités d'ADN possédant la séquence à amplifier et utilisées comme matrice, des paires d'amorces nucléotidiques complémentaires des séquences qui encadrent la cible à amplifier et un ensemble de quatre dNTP (dATP, dTTP, dCTP et dGTP) nécessaires à la synthèse de nouveaux brins d'ADN. A ce mélange, s'ajoute l'enzyme de polymérisation, la Taq DNA polymérase. C'est une enzyme thermorésistante qui fut isolée à l'origine de Thermus aquaticus, une bactérie thermophile.

Classiquement, la PCR consiste en la répétition de trois étapes thermiques réalisées successivement et connu sous le nom d'étapes d'un cycle d'amplification. Chaque étape est caractérisée par un temps et une température de réalisation qui déterminent l'efficacité de toute la PCR. Dans notre cas, le cycle d'amplification se présente comme suit :

· Première étape : le double brin d'ADN est d'abord chauffé à 94°C pendant 30 secondes ; ce qui permet de rompre les liaisons entre les deux brins. C'est l'étape de dénaturation ;

· Deuxième étape : la température est abaissée à 55°C pendant 30 secondes. Au cours de cette étape les amorces s'apparient spécifiquement sur leurs séquences complémentaires aux bornes de la région à amplifier, chacune sur son brin. C'est l'étape d'amorçage ou d'hybridation, annealing. La spécificité de la PCR repose sur la qualité de cet appariement lié à la taille des amorces et à leurs séquences ;

· Troisième étape : la température est élevée à 72°C pendant 1 minute 30 secondes. A cette température, la polymérase allonge les nouveaux brins d'ADN à partir des amorces en assemblant des dNTP. On parle d'étape de polymérisation, d'extension des amorces ou d'élongation des brins d'ADN (Figure 14).

À la fin de chaque cycle d'amplification, la séquence définie par les amorces initiales est dupliquée. Les brins d'ADN néoformés ainsi que les brins initiaux servent de matrice dans les cycles successifs d'amplification. C'est la répétition des cycles de dénaturation-hybridation-élongation qui conduit finalement à une accumulation exponentielle de l'ADN, c'est-à-dire à la réalisation de la PCR. La figure 14 ci-après présente le cycle d'amplification de la PCR que nous avons réalisée au LCB du CNRA à Adiopodoumé.

VII.2.3.2.2 - Choix des amorces et milieu réactionnel de la PCR

Le tableau 4 présente la liste et les caractéristiques de la paire d'amorces utilisées.

Tableau IV : Amorces choisies pour l'amplification des fragments ADNr 16S

Amorces

Séquences 5'3'

Sites

Références

FGPS 6

GGAGAGTTAAGATCTTGGCTCA

ADNr 16S

NORMAND et al., 1992

FGPS1509

AAGGAGGGGATCCAGCCGGA

ADNr 16S

NORMAND et al., 1992

Ces deux amorces utilisées sont spécifiques de l'ADNr 16S des rhizobia. Elles furent mises au point  en 1992 (NORMAND et al., 1992) et utilisées dans plusieurs études de diversité des rhizobia basée sur cette région (NDOYE, 1998 ; SY et al., 2001 etc.).

Avec ces amorces et les autres réactifs, le milieu réactionnel de la PCR se présente comme suit (Tableau 5) :

Tableau V : Composition du milieu réactionnel unitaire commun de la PCR

 

Concentration de travail

Volume utilisé pour un échantillon

Dntp

2 ,5 Mm

2 ul

Amorce 1 (FGPS 6)

2 uM

2,5 ul

Amorce 2 (FGPS 1509)

2 uM

2,5 ul

Tampon X 10

1 X

2,5 ul

Taq DNA polymerase

-

(0,5/15) ul

Eau PCR

-

13 ul

Volume réactionnel partiel

22,5 ul

Pour réaliser la PCR, chaque tube PCR a comporté en plus de ce milieu réactionnel commun, 2,5 à 4 ul d'ADN d'une et unique souche bactérienne. Ainsi, le volume réactionnel total par souche a été de 25 ul, le volume d'eau PCR ayant été ajusté en conséquence dans chaque cas. Au total, il y a eu 169 tubes PCR à 25 ul de réactif pour autant de souches à amplifier. Pour chaque réaction d'amplification, un microtube contenant uniquement le milieu réactionnel commun a été utilisé comme témoin négatif.

VII.2.3.2.3 - Programme de la PCR

Au cours de notre PCR, le cycle d'amplification à 3 étapes a été répété 35 fois. Celui-ci définit avec 2 autres cycles (une phase de préchauffage à 94 °C pendant 5 minutes et une phase terminale de réparation des bouts des fragments à 72°C pendant 7 min), le programme total de la PCR qui dure 2 heures 7 minutes. Ce programme se présente comme suit :

Etape 1 : 94°C-------- 5 minutes

Etape 2 : 94°C-------- 30 secondes

Etape 3 : 55°C-------- 30 secondes 35 cycles

Etape 4 : 72°C-------- 1 minute 30 seconde

Etape 5 : 72°C-------- 7 minutes

A la fin de la PCR, les amplifiats peuvent être conservés dans le thermocycleur à une température de 4°C. Cette phase de conservation correspond à une étape dite de pause. Dans le cas contraire, vers la fin du temps nécessaire à la PCR (2 h 7 min), un gel d'agarose à 0,8% est préparé pour réaliser l'électrophorèse des gènes une fois l'amplification terminée.

VII.2.3.2.4 - Electrophorèse sur gel d'agarose et visualisation des gels

· Préparation du gel d'agarose

Le gel d'agarose permet de suivre la migration des fragments d'ADN en fonction de leur taille et en milieu non dénaturant. Pour le préparer, 0,8g d'agarose est pesé et mélangé à 100 ml de tampon TBE (Tris Borate EDTA) 0,5X. L'ensemble est fondu au four micro-ondes et refroidi partiellement jusqu'à environ 60°C. Le gel ainsi obtenu est coloré au BET (Bromure d'Ethydium) et coulé dans un porte gel où des peignes sont préalablement placés pour créer les puits de migration. Après solidification complète du gel, les peignes sont enlevés et ce dernier est ainsi prêt pour l'électrophorèse.

· Dépôt des amplifiats

Le gel ainsi solidifié est placé à l'intérieur d'une cuve d'électrophorèse et recouvert de tampon TBE 0,5X. Dans chaque puits, est déposé, cinq à huit microlitres (ul) d'ADN (amplifiats) préalablement mélangés avec deux microlitres de tampon de charge (bleu de bromophénol). Parallèlement, 3 ul d'un marqueur de poids moléculaire 1Kb (100 pb à 12000 bp) est déposé sur le gel, entre 1 et 2 puits, pour vérifier la taille attendue de l'ADNr 16S amplifié. Enfin, l'allumage de l'appareil d'électrophorèse de type Mupid-One permet de mettre en migration pendant 30 minutes et à 100 V, les amplifiats déposés sur le gel.

VII.2.3.2.5 - Migration de l'ADN et visualisation

Après le temps de migration fixé, le gel est retiré de la cuve d'électrophorèse, puis déposé sur une plaque de lumière ultraviolette pour la visualisation. Sur cette plaque, la visualisation des amplifiats est rendue possible grâce au BET. En effet, celui-ci, en tant que cation, s'intercale entre les brins de l'ADN et rend ainsi le complexe ion éthidium-ADN fluoresçant sous l'éclairage UV. La prise d'images est effectuée à l'aide du transilluminateur à caméra relié à un ordinateur.

Après cette visualisation et les prises d'images, les souches dont le gène ADNr 16S a été correctement amplifié sont sélectionnées en vue de leur digestion.

VII.2.3.2.6 - Digestion des amplifiats

La digestion enzymatique du produit de la PCR a été réalisée sur les souches bien amplifiées. L'enzyme de restriction utilisée est la Tsp 509I (R0576S). Ses caractéristiques sont données dans le tableau 6 ci après.

Tableau VI : Caractéristiques de l'enzyme de restriction Tsp 509I

Enzyme de restriction

Sites à 4 paires de bases

Tsp 509I (R0576S)

5'...A A T T...3'

3'...T T A A...5'

Cette enzyme a été déjà utilisée pour digérer des amplifiats du gène ADNr 16S dans des études de diversité.

Le milieu réactionnel de la digestion se présente comme suit (Tableau 7) :

Tableau VII : Composition du milieu réactionnel unitaire commun de la digestion

 

Concentration de travail

Volume utilisé pour un échantillon

Tampon X 10

1 X

1,5 ul

Enzyme de digestion Tsp 509I

-

(2/10) ul

Eau PCR

-

3,5 ul

Volume réactionnel partiel

5 ul

Pour réaliser la digestion, chaque tube a comporté en plus de ce milieu réactionnel commun, 10 à 15 ul d'amplifiat d'une et unique souche bactérienne. Ainsi, le volume réactionnel total par souche varie entre 15 et 20 ul.

La digestion a eu lieu pendant 3 à 4 heures dans un bain marie chauffé à 65°C. Un témoin négatif constitué uniquement de 15 ul d'un bon amplifiat a accompagné chaque digestion.

À la fin de la digestion, la migration et la visualisation des fragments de restriction obtenus ont été effectuées dans les mêmes conditions que celles des produits PCR. Cependant, la petite taille des fragments de restriction générés a nécessité la préparation d'un gel d'agarose plus résolutif (agarose à 3%) et un temps de migration de 50 min. Aussi, note-on qu'ici, tout le produit de digestion de chaque souche (10 à 15 ul) a été entièrement mis en migration contrairement aux amplifiats.

CHAPITRE VIII : RESULTATS ET DISCUSSION

 

précédent sommaire suivant






La Quadrature du Net